Multiple sequence alignment - TraesCS3A01G460800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G460800 chr3A 100.000 2692 0 0 1 2692 696848351 696851042 0.000000e+00 4972
1 TraesCS3A01G460800 chr3A 99.331 2692 18 0 1 2692 696825876 696828567 0.000000e+00 4872
2 TraesCS3A01G460800 chr3A 98.440 2692 39 3 1 2692 696804455 696807143 0.000000e+00 4735
3 TraesCS3A01G460800 chr3A 98.109 2697 46 2 1 2692 696871127 696873823 0.000000e+00 4693
4 TraesCS3A01G460800 chr3A 98.192 2434 41 3 260 2692 696775516 696777947 0.000000e+00 4248
5 TraesCS3A01G460800 chr3A 97.153 281 8 0 1 281 696775123 696775403 2.430000e-130 475
6 TraesCS3A01G460800 chr3A 99.099 111 1 0 1 111 651917115 651917005 1.630000e-47 200
7 TraesCS3A01G460800 chr3A 99.099 111 1 0 1 111 651921904 651922014 1.630000e-47 200
8 TraesCS3A01G460800 chr3A 98.214 112 2 0 1 112 533821863 533821974 2.110000e-46 196
9 TraesCS3A01G460800 chr3A 96.552 116 3 1 1 116 22049881 22049995 9.840000e-45 191
10 TraesCS3A01G460800 chr2B 96.676 2106 68 2 588 2692 641594575 641592471 0.000000e+00 3500
11 TraesCS3A01G460800 chr1B 95.634 2107 72 4 587 2692 55337657 55339744 0.000000e+00 3363
12 TraesCS3A01G460800 chr1B 82.800 250 31 10 223 462 169001858 169002105 2.100000e-51 213
13 TraesCS3A01G460800 chr4B 97.216 1796 48 2 898 2692 74247071 74245277 0.000000e+00 3038
14 TraesCS3A01G460800 chr6B 89.952 209 21 0 2482 2690 415899078 415898870 1.230000e-68 270
15 TraesCS3A01G460800 chr6B 83.550 231 26 8 229 447 41708436 41708666 3.510000e-49 206
16 TraesCS3A01G460800 chr7B 88.517 209 24 0 2482 2690 223707551 223707759 1.240000e-63 254
17 TraesCS3A01G460800 chr5A 86.026 229 21 8 224 447 581297325 581297547 4.480000e-58 235
18 TraesCS3A01G460800 chr7A 83.260 227 28 6 229 453 433703591 433703809 1.630000e-47 200
19 TraesCS3A01G460800 chr7A 99.091 110 1 0 1 110 617400575 617400684 5.880000e-47 198
20 TraesCS3A01G460800 chr7A 77.193 342 73 3 2353 2690 35703127 35702787 7.600000e-46 195
21 TraesCS3A01G460800 chr2D 82.051 234 31 9 226 450 86490864 86490633 3.540000e-44 189


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G460800 chr3A 696848351 696851042 2691 False 4972.0 4972 100.0000 1 2692 1 chr3A.!!$F6 2691
1 TraesCS3A01G460800 chr3A 696825876 696828567 2691 False 4872.0 4872 99.3310 1 2692 1 chr3A.!!$F5 2691
2 TraesCS3A01G460800 chr3A 696804455 696807143 2688 False 4735.0 4735 98.4400 1 2692 1 chr3A.!!$F4 2691
3 TraesCS3A01G460800 chr3A 696871127 696873823 2696 False 4693.0 4693 98.1090 1 2692 1 chr3A.!!$F7 2691
4 TraesCS3A01G460800 chr3A 696775123 696777947 2824 False 2361.5 4248 97.6725 1 2692 2 chr3A.!!$F8 2691
5 TraesCS3A01G460800 chr2B 641592471 641594575 2104 True 3500.0 3500 96.6760 588 2692 1 chr2B.!!$R1 2104
6 TraesCS3A01G460800 chr1B 55337657 55339744 2087 False 3363.0 3363 95.6340 587 2692 1 chr1B.!!$F1 2105
7 TraesCS3A01G460800 chr4B 74245277 74247071 1794 True 3038.0 3038 97.2160 898 2692 1 chr4B.!!$R1 1794

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
577 717 1.05666 AACCCAGAAAAGGAGAGCGA 58.943 50.0 0.0 0.0 0.0 4.93 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2529 2672 0.471022 AAACCCCGGCAGTTCCAAAT 60.471 50.0 8.38 0.0 34.01 2.32 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
167 172 2.238084 TCTGTCACACCAGCTAGGAT 57.762 50.000 8.91 0.00 41.22 3.24
577 717 1.056660 AACCCAGAAAAGGAGAGCGA 58.943 50.000 0.00 0.00 0.00 4.93
1128 1268 1.707989 TGTTCTCCTACCATGGGCAAA 59.292 47.619 18.09 0.00 0.00 3.68
1454 1596 6.727697 TGATCATGGAAATAGGAGATCTGCTA 59.272 38.462 24.16 24.16 37.89 3.49
2529 2672 4.331968 ACGAAGCAAAATAAGGATCACCA 58.668 39.130 0.00 0.00 38.94 4.17
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
167 172 1.864725 TTGTGCCCGACGTCGTATCA 61.865 55.000 33.49 24.16 37.74 2.15
577 717 3.295800 GGACGGACCGATTCCACT 58.704 61.111 23.38 0.00 46.29 4.00
1128 1268 4.161102 AGAGCTTACCCACTTCTTGTAGT 58.839 43.478 0.00 0.00 0.00 2.73
1432 1574 5.483231 CCTAGCAGATCTCCTATTTCCATGA 59.517 44.000 0.00 0.00 0.00 3.07
1454 1596 4.100373 ACACTTCTCCTATTTGCTCTCCT 58.900 43.478 0.00 0.00 0.00 3.69
2529 2672 0.471022 AAACCCCGGCAGTTCCAAAT 60.471 50.000 8.38 0.00 34.01 2.32


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.