Multiple sequence alignment - TraesCS3A01G458700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G458700 chr3A 100.000 2435 0 0 1 2435 695638934 695641368 0 4497
1 TraesCS3A01G458700 chr3A 98.358 2436 38 2 1 2435 66006586 66004152 0 4276
2 TraesCS3A01G458700 chr3A 97.782 2435 52 2 1 2435 650015966 650013534 0 4196
3 TraesCS3A01G458700 chr6D 98.522 2436 35 1 1 2435 389247276 389244841 0 4298
4 TraesCS3A01G458700 chr7B 98.358 2436 39 1 1 2435 663100879 663098444 0 4276
5 TraesCS3A01G458700 chr7B 98.112 2436 45 1 1 2435 662724950 662727385 0 4242
6 TraesCS3A01G458700 chr5D 98.358 2436 39 1 1 2435 503243818 503246253 0 4276
7 TraesCS3A01G458700 chr2A 98.276 2436 41 1 1 2435 726907909 726905474 0 4265
8 TraesCS3A01G458700 chr3D 98.194 2436 40 4 1 2435 589264977 589262545 0 4252
9 TraesCS3A01G458700 chr3B 98.112 2437 44 2 1 2435 201538067 201540503 0 4244


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G458700 chr3A 695638934 695641368 2434 False 4497 4497 100.000 1 2435 1 chr3A.!!$F1 2434
1 TraesCS3A01G458700 chr3A 66004152 66006586 2434 True 4276 4276 98.358 1 2435 1 chr3A.!!$R1 2434
2 TraesCS3A01G458700 chr3A 650013534 650015966 2432 True 4196 4196 97.782 1 2435 1 chr3A.!!$R2 2434
3 TraesCS3A01G458700 chr6D 389244841 389247276 2435 True 4298 4298 98.522 1 2435 1 chr6D.!!$R1 2434
4 TraesCS3A01G458700 chr7B 663098444 663100879 2435 True 4276 4276 98.358 1 2435 1 chr7B.!!$R1 2434
5 TraesCS3A01G458700 chr7B 662724950 662727385 2435 False 4242 4242 98.112 1 2435 1 chr7B.!!$F1 2434
6 TraesCS3A01G458700 chr5D 503243818 503246253 2435 False 4276 4276 98.358 1 2435 1 chr5D.!!$F1 2434
7 TraesCS3A01G458700 chr2A 726905474 726907909 2435 True 4265 4265 98.276 1 2435 1 chr2A.!!$R1 2434
8 TraesCS3A01G458700 chr3D 589262545 589264977 2432 True 4252 4252 98.194 1 2435 1 chr3D.!!$R1 2434
9 TraesCS3A01G458700 chr3B 201538067 201540503 2436 False 4244 4244 98.112 1 2435 1 chr3B.!!$F1 2434

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
873 875 0.249322 GCGACGGGCTATTAGCTCAA 60.249 55.0 15.64 0.0 43.44 3.02 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1706 1713 1.69415 TGGACTTGAACCAGAGACCTG 59.306 52.381 0.0 0.0 40.09 4.0 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
253 254 1.072332 ACACGTGCTACAATGGGCA 59.928 52.632 17.22 0.00 36.01 5.36
363 364 3.068307 AGCAGGAATCGCTAGTAATCGTT 59.932 43.478 0.00 0.00 38.15 3.85
767 769 2.041301 CGTCCCCATGTCCCCCTA 60.041 66.667 0.00 0.00 0.00 3.53
825 827 3.020984 TGGAGTTTTTCTCGCTTTTGGT 58.979 40.909 0.00 0.00 43.60 3.67
873 875 0.249322 GCGACGGGCTATTAGCTCAA 60.249 55.000 15.64 0.00 43.44 3.02
874 876 1.488527 CGACGGGCTATTAGCTCAAC 58.511 55.000 15.64 7.48 43.44 3.18
951 953 4.400251 CAGCCACATGGATAGTTCAATGTT 59.600 41.667 0.87 0.00 42.79 2.71
1005 1007 0.818938 CAAGGCACATTAGCATGGCA 59.181 50.000 0.00 0.00 43.55 4.92
1163 1169 0.967887 CCACGGCTCCTCTCTTCTCA 60.968 60.000 0.00 0.00 0.00 3.27
1218 1224 2.542824 GCTATCTCTCGAGCACAGGTTC 60.543 54.545 7.81 0.00 38.62 3.62
1277 1284 3.005554 CGCATCTTCACAGACCAAGAAT 58.994 45.455 0.00 0.00 32.40 2.40
1308 1315 2.834638 CCCTTTCATTCTGGGGTGAT 57.165 50.000 0.00 0.00 37.37 3.06
1386 1393 5.990120 AAGCAGCAATCAATAGGACTTTT 57.010 34.783 0.00 0.00 0.00 2.27
1525 1532 2.436417 CTTCCTTTTTCTGCCCATCGA 58.564 47.619 0.00 0.00 0.00 3.59
1540 1547 4.270008 CCCATCGAAGTTATTTCCCAAGT 58.730 43.478 0.00 0.00 31.82 3.16
1640 1647 0.469917 GGAAGGATGAATCGCTCCCA 59.530 55.000 0.00 0.00 31.49 4.37
1706 1713 1.597663 CGATGATTTACTTCACGGGCC 59.402 52.381 0.00 0.00 0.00 5.80
1799 1806 0.983467 TGCATACTCCACTTGGCTCA 59.017 50.000 0.00 0.00 34.44 4.26
1961 1968 2.906389 AGAGGACTGAAACATGCCACTA 59.094 45.455 0.00 0.00 0.00 2.74
2129 2136 2.562296 AGAGGATCAAGTTGGCCCTTA 58.438 47.619 15.10 0.00 37.82 2.69
2375 2382 4.215613 GGGCAATCACTCGTTCTTAAAACT 59.784 41.667 0.00 0.00 0.00 2.66
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
44 45 2.590575 CCACCTGTGTCCGCGTTT 60.591 61.111 4.92 0.00 0.00 3.60
253 254 1.218316 GATCGCGACCCTTTGTCCT 59.782 57.895 12.93 0.00 41.18 3.85
767 769 2.685366 CCCATGCCTCCACACCAT 59.315 61.111 0.00 0.00 0.00 3.55
825 827 1.685224 CAAAGGGAGGCCTGCTACA 59.315 57.895 24.77 0.00 0.00 2.74
951 953 2.725312 GGGTCAGGCGCTGATGAGA 61.725 63.158 7.64 0.00 42.73 3.27
1005 1007 4.030913 TCCGATTCAAACAGGAGGAGTAT 58.969 43.478 0.00 0.00 0.00 2.12
1163 1169 7.072961 ACACTGATAAGGGATGTATGGATTCTT 59.927 37.037 0.00 0.00 0.00 2.52
1277 1284 4.469945 AGAATGAAAGGGGTGATCTCGTAA 59.530 41.667 0.00 0.00 0.00 3.18
1308 1315 1.037493 CGAATGGTACGATCCCTCCA 58.963 55.000 0.00 0.93 0.00 3.86
1414 1421 8.709308 TCCCATTTAAGGAAAAAGAATTTCACA 58.291 29.630 0.00 0.00 37.28 3.58
1525 1532 5.390387 TGGCAAGTACTTGGGAAATAACTT 58.610 37.500 31.42 0.00 40.74 2.66
1540 1547 2.771943 CTCCCTCTTACCATGGCAAGTA 59.228 50.000 21.74 9.80 0.00 2.24
1640 1647 7.037297 TGGGAGAGAATCAATAGACTCCTTTTT 60.037 37.037 0.00 0.00 42.17 1.94
1706 1713 1.694150 TGGACTTGAACCAGAGACCTG 59.306 52.381 0.00 0.00 40.09 4.00
1961 1968 9.050601 CATCTTTTTGTCTCAGTAGAGTCTTTT 57.949 33.333 0.00 0.00 42.66 2.27
2129 2136 5.986135 GGAGATAGTGCATCAAGTTATTCGT 59.014 40.000 0.00 0.00 35.96 3.85
2375 2382 6.980978 CCGACTCTTTGATCTTAAGAATGCTA 59.019 38.462 9.71 0.00 31.67 3.49


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.