Multiple sequence alignment - TraesCS3A01G456900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G456900 chr3A 100.000 2487 0 0 1 2487 694375571 694373085 0 4593
1 TraesCS3A01G456900 chr3A 96.061 2488 81 5 1 2487 227655542 227658013 0 4036
2 TraesCS3A01G456900 chr6B 98.353 2489 39 2 1 2487 596620323 596622811 0 4368
3 TraesCS3A01G456900 chrUn 98.272 2489 41 2 1 2487 86510013 86507525 0 4357
4 TraesCS3A01G456900 chrUn 98.232 2489 42 2 1 2487 282364697 282362209 0 4351
5 TraesCS3A01G456900 chr3B 98.030 2487 48 1 1 2487 92317837 92320322 0 4320
6 TraesCS3A01G456900 chr3B 97.349 2490 51 9 1 2487 6031892 6034369 0 4218
7 TraesCS3A01G456900 chr3B 95.540 2489 100 10 1 2487 368696997 368699476 0 3971
8 TraesCS3A01G456900 chr6A 97.713 2492 52 3 1 2487 84434143 84436634 0 4281
9 TraesCS3A01G456900 chr2B 97.750 2489 49 7 1 2487 30670612 30668129 0 4279


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G456900 chr3A 694373085 694375571 2486 True 4593 4593 100.000 1 2487 1 chr3A.!!$R1 2486
1 TraesCS3A01G456900 chr3A 227655542 227658013 2471 False 4036 4036 96.061 1 2487 1 chr3A.!!$F1 2486
2 TraesCS3A01G456900 chr6B 596620323 596622811 2488 False 4368 4368 98.353 1 2487 1 chr6B.!!$F1 2486
3 TraesCS3A01G456900 chrUn 86507525 86510013 2488 True 4357 4357 98.272 1 2487 1 chrUn.!!$R1 2486
4 TraesCS3A01G456900 chrUn 282362209 282364697 2488 True 4351 4351 98.232 1 2487 1 chrUn.!!$R2 2486
5 TraesCS3A01G456900 chr3B 92317837 92320322 2485 False 4320 4320 98.030 1 2487 1 chr3B.!!$F2 2486
6 TraesCS3A01G456900 chr3B 6031892 6034369 2477 False 4218 4218 97.349 1 2487 1 chr3B.!!$F1 2486
7 TraesCS3A01G456900 chr3B 368696997 368699476 2479 False 3971 3971 95.540 1 2487 1 chr3B.!!$F3 2486
8 TraesCS3A01G456900 chr6A 84434143 84436634 2491 False 4281 4281 97.713 1 2487 1 chr6A.!!$F1 2486
9 TraesCS3A01G456900 chr2B 30668129 30670612 2483 True 4279 4279 97.750 1 2487 1 chr2B.!!$R1 2486

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
115 116 0.463654 TCGAAGCCCAATTAGCGCAT 60.464 50.000 11.47 0.0 34.64 4.73 F
783 788 3.326588 TCTTCAAAACTTCTCGGGATCCA 59.673 43.478 15.23 0.0 0.00 3.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1284 1289 1.400737 CCCCCGTCTTACTAGACCAG 58.599 60.000 0.00 0.0 46.63 4.00 R
2250 2265 1.270550 CGCTTCTTTTCCACCAAGCAT 59.729 47.619 3.62 0.0 41.17 3.79 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
56 57 5.304686 TGGAACAGTTTAGGACAGAACAT 57.695 39.130 0.00 0.00 0.00 2.71
115 116 0.463654 TCGAAGCCCAATTAGCGCAT 60.464 50.000 11.47 0.00 34.64 4.73
579 584 5.050490 CCGAAAACGAGTCAAGATGGATAT 58.950 41.667 0.00 0.00 0.00 1.63
783 788 3.326588 TCTTCAAAACTTCTCGGGATCCA 59.673 43.478 15.23 0.00 0.00 3.41
922 927 9.740239 ATAGAAAATCGAAAACGTACATAGCTA 57.260 29.630 0.00 0.00 0.00 3.32
1170 1175 7.120726 GTGGCTACATTTATGTTAAGTCTGGTT 59.879 37.037 0.02 0.00 41.97 3.67
1227 1232 5.010719 GGTATTGTCAGATCCGAACATAGGA 59.989 44.000 0.00 0.00 42.69 2.94
1249 1254 8.051901 AGGACTACTTTATTTGTTTGCCATAC 57.948 34.615 0.00 0.00 0.00 2.39
1284 1289 8.244113 GGTGTTTATGGAATAATTATAGCAGGC 58.756 37.037 0.00 0.00 38.83 4.85
1752 1759 4.504858 CCTACTCATTTTTGTAGGCGAGT 58.495 43.478 6.30 0.00 46.01 4.18
1830 1837 5.892160 TCTACTACGCTACACAAAGTCAT 57.108 39.130 0.00 0.00 0.00 3.06
1924 1931 0.043032 TAACCTTTAGCTCCCCGGGA 59.957 55.000 26.32 5.87 0.00 5.14
1943 1950 0.671781 ACTAAGCTGCTTCGCACCAG 60.672 55.000 19.62 11.84 33.79 4.00
1975 1982 9.875691 GTTAATTAAGATTCCATTTCAAAGGCT 57.124 29.630 0.00 0.00 0.00 4.58
2061 2068 4.679373 ATCCGTAAATCAGAGAGCATGT 57.321 40.909 0.00 0.00 0.00 3.21
2099 2109 5.103728 TGGTCCCCTATGCATTTCATTCTTA 60.104 40.000 3.54 0.00 36.63 2.10
2250 2265 7.094463 CGACCTACAGTTCTCCTTAAACTTCTA 60.094 40.741 0.00 0.00 34.79 2.10
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
56 57 0.108615 GCTCGCTTTCTACTGAGGCA 60.109 55.000 0.00 0.0 0.00 4.75
579 584 7.876068 GGTAATCCACGATGTCTCCATTTTATA 59.124 37.037 0.00 0.0 0.00 0.98
783 788 5.627135 TGGGACCTTTTATCGAAAAACTCT 58.373 37.500 0.00 0.0 34.16 3.24
922 927 5.722021 AAACAAAGTATTTCCGCTGGAAT 57.278 34.783 10.19 0.0 41.71 3.01
981 986 6.889198 AGCCATTACTTTATGTTCAGCTAGA 58.111 36.000 0.00 0.0 0.00 2.43
992 997 5.633182 CGTTGCACAAAAGCCATTACTTTAT 59.367 36.000 0.00 0.0 38.92 1.40
1170 1175 2.281900 GGTACAACGGCCCAAGCA 60.282 61.111 0.00 0.0 42.56 3.91
1227 1232 8.417273 AAGGTATGGCAAACAAATAAAGTAGT 57.583 30.769 0.00 0.0 0.00 2.73
1284 1289 1.400737 CCCCCGTCTTACTAGACCAG 58.599 60.000 0.00 0.0 46.63 4.00
1310 1315 3.066342 CCGTATATCATAGGCGACCGAAT 59.934 47.826 0.00 0.0 0.00 3.34
1398 1404 2.310779 TATGAGCCCTAGCCCTGTAG 57.689 55.000 0.00 0.0 41.25 2.74
1492 1498 2.037121 TGAGGTGCGAAGAGAAACATCA 59.963 45.455 0.00 0.0 31.55 3.07
1686 1693 5.392703 CCGCTGACTTTGACTGTACTGTATA 60.393 44.000 5.27 0.0 0.00 1.47
1687 1694 4.486090 CGCTGACTTTGACTGTACTGTAT 58.514 43.478 5.27 0.0 0.00 2.29
1719 1726 2.478872 ATGAGTAGGCAAGGCTAGGA 57.521 50.000 3.35 0.0 0.00 2.94
1752 1759 2.427453 CCTAAGCCTCTTCGCTAACTCA 59.573 50.000 0.00 0.0 38.44 3.41
1830 1837 7.533426 ACTCTCTTAATTAACGTCGAGCTAAA 58.467 34.615 0.00 0.0 0.00 1.85
1975 1982 2.846193 AGGCTTGCGAAACAAAGTAGA 58.154 42.857 0.00 0.0 37.96 2.59
2099 2109 5.622770 ACTTTAATTCTTTGCGTTCCGAT 57.377 34.783 0.00 0.0 0.00 4.18
2250 2265 1.270550 CGCTTCTTTTCCACCAAGCAT 59.729 47.619 3.62 0.0 41.17 3.79
2362 2377 8.307483 CGAAGATGGGTAATATGTTCTCATACT 58.693 37.037 0.00 0.0 39.03 2.12
2459 2474 3.425659 AGGGGAGATCAAAACAAGAAGC 58.574 45.455 0.00 0.0 0.00 3.86


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.