Multiple sequence alignment - TraesCS3A01G454200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G454200 chr3A 100.000 2336 0 0 1 2336 692573732 692571397 0.000000e+00 4314
1 TraesCS3A01G454200 chr3A 96.856 1781 41 11 561 2336 672914970 672916740 0.000000e+00 2964
2 TraesCS3A01G454200 chr3A 95.398 565 19 4 1 560 692551314 692550752 0.000000e+00 893
3 TraesCS3A01G454200 chr3A 92.216 167 11 2 2161 2326 642679614 642679449 3.880000e-58 235
4 TraesCS3A01G454200 chr5D 97.591 1785 32 7 561 2336 560879839 560878057 0.000000e+00 3048
5 TraesCS3A01G454200 chr5D 97.113 1732 31 10 615 2336 503213219 503211497 0.000000e+00 2904
6 TraesCS3A01G454200 chrUn 97.480 1786 33 9 561 2336 93416977 93418760 0.000000e+00 3038
7 TraesCS3A01G454200 chr1D 97.370 1787 34 8 561 2336 144238077 144236293 0.000000e+00 3027
8 TraesCS3A01G454200 chr3B 96.586 1787 44 13 561 2336 201522044 201520264 0.000000e+00 2946
9 TraesCS3A01G454200 chr6A 96.577 1782 49 10 562 2336 271184816 271183040 0.000000e+00 2942
10 TraesCS3A01G454200 chr6A 95.213 564 20 4 1 560 96175147 96174587 0.000000e+00 885
11 TraesCS3A01G454200 chr1A 95.677 1781 63 13 561 2336 168443253 168445024 0.000000e+00 2850
12 TraesCS3A01G454200 chr1A 94.894 568 21 6 1 564 284991476 284992039 0.000000e+00 881
13 TraesCS3A01G454200 chr2D 97.370 1635 31 10 561 2185 272798863 272800495 0.000000e+00 2771
14 TraesCS3A01G454200 chr4A 95.044 565 22 3 1 560 447269299 447268736 0.000000e+00 883
15 TraesCS3A01G454200 chr4A 95.035 564 21 4 1 560 109860641 109861201 0.000000e+00 880
16 TraesCS3A01G454200 chr2A 94.885 567 20 5 1 560 593646572 593646008 0.000000e+00 878
17 TraesCS3A01G454200 chr2A 94.552 569 26 4 1 564 673944477 673943909 0.000000e+00 874
18 TraesCS3A01G454200 chr7A 94.876 566 20 6 1 560 69541132 69541694 0.000000e+00 876
19 TraesCS3A01G454200 chr5A 94.386 570 26 4 1 565 508879865 508880433 0.000000e+00 870


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G454200 chr3A 692571397 692573732 2335 True 4314 4314 100.000 1 2336 1 chr3A.!!$R3 2335
1 TraesCS3A01G454200 chr3A 672914970 672916740 1770 False 2964 2964 96.856 561 2336 1 chr3A.!!$F1 1775
2 TraesCS3A01G454200 chr3A 692550752 692551314 562 True 893 893 95.398 1 560 1 chr3A.!!$R2 559
3 TraesCS3A01G454200 chr5D 560878057 560879839 1782 True 3048 3048 97.591 561 2336 1 chr5D.!!$R2 1775
4 TraesCS3A01G454200 chr5D 503211497 503213219 1722 True 2904 2904 97.113 615 2336 1 chr5D.!!$R1 1721
5 TraesCS3A01G454200 chrUn 93416977 93418760 1783 False 3038 3038 97.480 561 2336 1 chrUn.!!$F1 1775
6 TraesCS3A01G454200 chr1D 144236293 144238077 1784 True 3027 3027 97.370 561 2336 1 chr1D.!!$R1 1775
7 TraesCS3A01G454200 chr3B 201520264 201522044 1780 True 2946 2946 96.586 561 2336 1 chr3B.!!$R1 1775
8 TraesCS3A01G454200 chr6A 271183040 271184816 1776 True 2942 2942 96.577 562 2336 1 chr6A.!!$R2 1774
9 TraesCS3A01G454200 chr6A 96174587 96175147 560 True 885 885 95.213 1 560 1 chr6A.!!$R1 559
10 TraesCS3A01G454200 chr1A 168443253 168445024 1771 False 2850 2850 95.677 561 2336 1 chr1A.!!$F1 1775
11 TraesCS3A01G454200 chr1A 284991476 284992039 563 False 881 881 94.894 1 564 1 chr1A.!!$F2 563
12 TraesCS3A01G454200 chr2D 272798863 272800495 1632 False 2771 2771 97.370 561 2185 1 chr2D.!!$F1 1624
13 TraesCS3A01G454200 chr4A 447268736 447269299 563 True 883 883 95.044 1 560 1 chr4A.!!$R1 559
14 TraesCS3A01G454200 chr4A 109860641 109861201 560 False 880 880 95.035 1 560 1 chr4A.!!$F1 559
15 TraesCS3A01G454200 chr2A 593646008 593646572 564 True 878 878 94.885 1 560 1 chr2A.!!$R1 559
16 TraesCS3A01G454200 chr2A 673943909 673944477 568 True 874 874 94.552 1 564 1 chr2A.!!$R2 563
17 TraesCS3A01G454200 chr7A 69541132 69541694 562 False 876 876 94.876 1 560 1 chr7A.!!$F1 559
18 TraesCS3A01G454200 chr5A 508879865 508880433 568 False 870 870 94.386 1 565 1 chr5A.!!$F1 564

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
405 426 0.034477 AAACTTTCCCGATGGCCGAT 60.034 50.0 0.0 0.0 41.76 4.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2030 2073 2.752903 CAGCGCCCTTTACCATAACTTT 59.247 45.455 2.29 0.0 0.0 2.66 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
124 136 5.439059 CCCACTATATATAGGACCCCTAGGT 59.561 48.000 21.20 0.0 39.70 3.08
125 137 6.374588 CCACTATATATAGGACCCCTAGGTG 58.625 48.000 21.20 0.0 39.70 4.00
405 426 0.034477 AAACTTTCCCGATGGCCGAT 60.034 50.000 0.00 0.0 41.76 4.18
656 678 7.418337 AGAGGGTTTTATTGAAAGTGTTTGT 57.582 32.000 0.00 0.0 0.00 2.83
673 695 6.533819 TGTTTGTAAACATCAGGAACGTAG 57.466 37.500 6.11 0.0 43.45 3.51
764 786 7.012989 ACAAGAACCTTTTTAAAGCGTATCAGT 59.987 33.333 0.00 0.0 34.69 3.41
777 799 1.406539 GTATCAGTCGACCCGGCTTAA 59.593 52.381 13.01 0.0 39.37 1.85
826 848 3.901222 CCTAAAGTTTTGGGTGGAATGGT 59.099 43.478 8.09 0.0 34.45 3.55
1053 1084 6.093633 ACACGAGAGAAGCAAAAGTAACTTTT 59.906 34.615 0.00 0.0 43.36 2.27
1191 1222 4.320398 TGATGGGGGATAGGGTCAAAATA 58.680 43.478 0.00 0.0 0.00 1.40
1201 1232 7.715686 GGGATAGGGTCAAAATAGAAGTAAGTG 59.284 40.741 0.00 0.0 0.00 3.16
1202 1233 8.483758 GGATAGGGTCAAAATAGAAGTAAGTGA 58.516 37.037 0.00 0.0 0.00 3.41
1311 1342 6.422776 TTGAAGGATAGCGAAGATTTGAAC 57.577 37.500 0.00 0.0 0.00 3.18
1396 1430 9.436957 TTCTAAAATTCAAGCGAAGAGACTTAT 57.563 29.630 0.00 0.0 33.74 1.73
1397 1431 9.436957 TCTAAAATTCAAGCGAAGAGACTTATT 57.563 29.630 0.00 0.0 33.74 1.40
1790 1831 3.490526 GGTTCACGTAAGAAAGTGCGTAA 59.509 43.478 0.00 0.0 43.62 3.18
1834 1875 5.107220 CGTTTTAGTTTACGGAAGAGTGCAT 60.107 40.000 0.00 0.0 34.30 3.96
1845 1886 4.207224 CGGAAGAGTGCATGTAGAATAACG 59.793 45.833 0.00 0.0 0.00 3.18
1991 2034 3.010584 ACCCTATGCTGGTCAAAGAACAT 59.989 43.478 0.00 0.0 0.00 2.71
2070 2113 0.824759 GGTAGTGGAAGAGATGCCGT 59.175 55.000 0.00 0.0 0.00 5.68
2073 2116 3.825014 GGTAGTGGAAGAGATGCCGTATA 59.175 47.826 0.00 0.0 0.00 1.47
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
143 156 1.430369 CCCCCTTGGAGATCCCATCC 61.430 65.000 4.04 0.00 46.10 3.51
656 678 4.794278 TCTGCTACGTTCCTGATGTTTA 57.206 40.909 0.00 0.00 0.00 2.01
673 695 7.359514 GCAAAGTTGAAACCAAGAAATATCTGC 60.360 37.037 0.00 0.00 35.59 4.26
764 786 2.773993 AAATTCTTAAGCCGGGTCGA 57.226 45.000 6.62 0.76 0.00 4.20
1030 1061 6.679327 AAAAGTTACTTTTGCTTCTCTCGT 57.321 33.333 20.54 0.00 41.38 4.18
1053 1084 3.557686 GGGCTTCCGTAACTAAACCTTCA 60.558 47.826 0.00 0.00 0.00 3.02
1191 1222 9.453572 TTGCTTGAATCATAATCACTTACTTCT 57.546 29.630 0.00 0.00 0.00 2.85
1201 1232 4.576463 ACGTCCCTTGCTTGAATCATAATC 59.424 41.667 0.00 0.00 0.00 1.75
1202 1233 4.526970 ACGTCCCTTGCTTGAATCATAAT 58.473 39.130 0.00 0.00 0.00 1.28
1311 1342 7.499232 ACCTAATCCTTTGAATCTTTGGTATCG 59.501 37.037 0.00 0.00 0.00 2.92
1667 1704 6.943718 ACAAAGATATCCGTTTCAGGGTAAAA 59.056 34.615 0.00 0.00 29.46 1.52
1790 1831 2.933906 CGTGCATTCCTACGTAAACCAT 59.066 45.455 0.00 0.00 35.70 3.55
1845 1886 5.185828 AGCTTGAACATGAATAACCCCTTTC 59.814 40.000 0.00 0.00 0.00 2.62
1991 2034 6.427242 CCTACTGTACGAATAGCATCTACTGA 59.573 42.308 0.00 0.00 0.00 3.41
2029 2072 3.014623 AGCGCCCTTTACCATAACTTTC 58.985 45.455 2.29 0.00 0.00 2.62
2030 2073 2.752903 CAGCGCCCTTTACCATAACTTT 59.247 45.455 2.29 0.00 0.00 2.66


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.