Multiple sequence alignment - TraesCS3A01G452200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G452200 chr3A 100.000 2354 0 0 1 2354 690371643 690369290 0.000000e+00 4348
1 TraesCS3A01G452200 chr3A 98.013 1258 25 0 1 1258 690398595 690397338 0.000000e+00 2185
2 TraesCS3A01G452200 chr3A 96.496 1113 37 1 1244 2354 690391082 690389970 0.000000e+00 1838
3 TraesCS3A01G452200 chr3A 96.406 1113 37 2 1244 2354 690418604 690417493 0.000000e+00 1831
4 TraesCS3A01G452200 chr3A 98.686 989 12 1 1 989 690425826 690424839 0.000000e+00 1753
5 TraesCS3A01G452200 chr3A 91.255 789 50 8 744 1524 690460742 690459965 0.000000e+00 1057
6 TraesCS3A01G452200 chr3B 89.200 963 61 18 744 1683 735381948 735381006 0.000000e+00 1162
7 TraesCS3A01G452200 chr3B 86.322 658 56 14 829 1478 735200664 735200033 0.000000e+00 686
8 TraesCS3A01G452200 chr3B 84.529 446 25 7 145 583 735210088 735209680 3.640000e-108 401
9 TraesCS3A01G452200 chr3B 82.988 482 42 13 1875 2354 734879268 734878825 1.310000e-107 399
10 TraesCS3A01G452200 chr3B 89.899 297 22 7 1875 2165 735380842 735380548 2.210000e-100 375
11 TraesCS3A01G452200 chr3B 85.915 284 25 9 265 536 735383876 735383596 2.960000e-74 289
12 TraesCS3A01G452200 chr3B 95.283 106 2 3 635 738 735209672 735209568 5.200000e-37 165
13 TraesCS3A01G452200 chr3B 90.741 108 9 1 1767 1874 735380980 735380874 2.440000e-30 143
14 TraesCS3A01G452200 chr3B 80.874 183 17 11 558 738 735383606 735383440 6.830000e-26 128
15 TraesCS3A01G452200 chr3B 85.849 106 8 4 745 843 735209345 735209240 3.200000e-19 106
16 TraesCS3A01G452200 chr3D 90.521 844 58 8 744 1580 553927593 553926765 0.000000e+00 1096
17 TraesCS3A01G452200 chr3D 80.237 253 29 13 300 536 553929291 553929044 1.120000e-38 171
18 TraesCS3A01G452200 chr6D 93.836 146 9 0 1 146 16627498 16627353 1.100000e-53 220
19 TraesCS3A01G452200 chr6D 93.243 148 10 0 1 148 266380750 266380603 3.940000e-53 219
20 TraesCS3A01G452200 chr1D 93.243 148 10 0 1 148 31307416 31307269 3.940000e-53 219
21 TraesCS3A01G452200 chr7D 91.216 148 13 0 1 148 621955377 621955524 3.970000e-48 202
22 TraesCS3A01G452200 chr6A 89.726 146 15 0 1 146 431938909 431938764 1.110000e-43 187


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G452200 chr3A 690369290 690371643 2353 True 4348.0 4348 100.000000 1 2354 1 chr3A.!!$R1 2353
1 TraesCS3A01G452200 chr3A 690397338 690398595 1257 True 2185.0 2185 98.013000 1 1258 1 chr3A.!!$R3 1257
2 TraesCS3A01G452200 chr3A 690389970 690391082 1112 True 1838.0 1838 96.496000 1244 2354 1 chr3A.!!$R2 1110
3 TraesCS3A01G452200 chr3A 690417493 690418604 1111 True 1831.0 1831 96.406000 1244 2354 1 chr3A.!!$R4 1110
4 TraesCS3A01G452200 chr3A 690424839 690425826 987 True 1753.0 1753 98.686000 1 989 1 chr3A.!!$R5 988
5 TraesCS3A01G452200 chr3A 690459965 690460742 777 True 1057.0 1057 91.255000 744 1524 1 chr3A.!!$R6 780
6 TraesCS3A01G452200 chr3B 735200033 735200664 631 True 686.0 686 86.322000 829 1478 1 chr3B.!!$R2 649
7 TraesCS3A01G452200 chr3B 735380548 735383876 3328 True 419.4 1162 87.325800 265 2165 5 chr3B.!!$R4 1900
8 TraesCS3A01G452200 chr3B 735209240 735210088 848 True 224.0 401 88.553667 145 843 3 chr3B.!!$R3 698
9 TraesCS3A01G452200 chr3D 553926765 553929291 2526 True 633.5 1096 85.379000 300 1580 2 chr3D.!!$R1 1280

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
98 99 2.048503 GGCGGTGTCGTTAGCAGT 60.049 61.111 0.0 0.0 38.89 4.40 F
741 2292 4.842531 TCCACTGTCCAACATCATGTAT 57.157 40.909 0.0 0.0 0.00 2.29 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1215 2776 0.321919 GGAACCTGAGCATGCAGTCA 60.322 55.0 21.98 14.77 34.06 3.41 R
1776 3355 2.192664 TATGCCGCCTTTTGAGACAA 57.807 45.0 0.00 0.00 0.00 3.18 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
86 87 3.210012 AACTCATGGCAAGGGCGGT 62.210 57.895 0.00 0.00 42.47 5.68
98 99 2.048503 GGCGGTGTCGTTAGCAGT 60.049 61.111 0.00 0.00 38.89 4.40
741 2292 4.842531 TCCACTGTCCAACATCATGTAT 57.157 40.909 0.00 0.00 0.00 2.29
1248 2809 1.004440 GTTCCACAAGCGCTCCTCT 60.004 57.895 12.06 0.00 0.00 3.69
1305 2866 1.485124 TCAGCTCCGTCCACATGTAT 58.515 50.000 0.00 0.00 0.00 2.29
1309 2870 1.134818 GCTCCGTCCACATGTATGACA 60.135 52.381 21.12 7.60 0.00 3.58
1377 2938 3.002583 TGGCTGGCTGATCGTCCA 61.003 61.111 2.00 5.73 0.00 4.02
1454 3021 0.455802 CATCCTCATCGATCTCCGCG 60.456 60.000 0.00 0.00 38.37 6.46
1798 3377 2.423185 TGTCTCAAAAGGCGGCATATTG 59.577 45.455 13.08 13.00 0.00 1.90
1963 3574 4.198625 GCTCGTGCAGCTTCTGAT 57.801 55.556 4.26 0.00 45.83 2.90
2194 3809 3.874543 GTGTCATACCAACACACTCACAA 59.125 43.478 1.72 0.00 45.05 3.33
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
71 72 3.918253 GACACCGCCCTTGCCATGA 62.918 63.158 0.00 0.00 0.00 3.07
86 87 1.733912 ACGACGATACTGCTAACGACA 59.266 47.619 0.00 0.00 0.00 4.35
98 99 3.091545 ACCCTAAACTTGGACGACGATA 58.908 45.455 0.00 0.00 0.00 2.92
741 2292 0.904865 ATTCACTCTGGGCGAGACCA 60.905 55.000 0.00 0.00 42.62 4.02
1215 2776 0.321919 GGAACCTGAGCATGCAGTCA 60.322 55.000 21.98 14.77 34.06 3.41
1248 2809 0.395862 GGAGGGAGATGAGGTCGACA 60.396 60.000 18.91 0.00 0.00 4.35
1305 2866 1.469767 CGGCTCTTGATGACGATGTCA 60.470 52.381 1.65 1.65 46.90 3.58
1309 2870 1.589993 CGCGGCTCTTGATGACGAT 60.590 57.895 0.00 0.00 0.00 3.73
1377 2938 2.216898 GCTTGCTTCTATCGAATGGCT 58.783 47.619 0.00 0.00 0.00 4.75
1454 3021 3.702548 ACACAAGGTGGAAAAGTTAACCC 59.297 43.478 0.88 0.00 37.94 4.11
1714 3293 7.227873 TCAACCACATATTAGTTTGGAGTGAA 58.772 34.615 0.00 0.00 33.02 3.18
1729 3308 7.039434 TGCTAACCATTCAATTTCAACCACATA 60.039 33.333 0.00 0.00 0.00 2.29
1776 3355 2.192664 TATGCCGCCTTTTGAGACAA 57.807 45.000 0.00 0.00 0.00 3.18
1798 3377 6.147328 AGCGAAAACATCACCTTCTACTAAAC 59.853 38.462 0.00 0.00 0.00 2.01
2028 3639 3.803778 CACCTGTCAACCTTTCATTTTGC 59.196 43.478 0.00 0.00 0.00 3.68
2194 3809 4.537135 ACAGTAGGACGATGTGTGATTT 57.463 40.909 0.00 0.00 0.00 2.17


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.