Multiple sequence alignment - TraesCS3A01G451500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G451500 chr3A 100.000 2559 0 0 1 2559 689578151 689580709 0.000000e+00 4726
1 TraesCS3A01G451500 chr3A 98.750 2559 32 0 1 2559 689607929 689610487 0.000000e+00 4549
2 TraesCS3A01G451500 chr3A 97.713 1399 29 2 277 1672 689523296 689524694 0.000000e+00 2403
3 TraesCS3A01G451500 chr3A 87.991 1274 126 17 373 1627 689659666 689660931 0.000000e+00 1480
4 TraesCS3A01G451500 chr3A 88.031 1270 126 16 376 1627 689662507 689663768 0.000000e+00 1480
5 TraesCS3A01G451500 chr3A 86.919 1269 135 17 376 1627 689666322 689667576 0.000000e+00 1410
6 TraesCS3A01G451500 chr3A 85.086 818 105 8 822 1627 686281128 686280316 0.000000e+00 819
7 TraesCS3A01G451500 chr3A 85.445 797 96 9 662 1438 689867182 689867978 0.000000e+00 811
8 TraesCS3A01G451500 chr3A 84.944 797 100 9 662 1438 689846868 689847664 0.000000e+00 789
9 TraesCS3A01G451500 chr3A 88.082 537 54 5 376 905 689866848 689867381 1.670000e-176 628
10 TraesCS3A01G451500 chr3A 88.980 490 49 4 277 763 686281530 686281043 3.640000e-168 601
11 TraesCS3A01G451500 chr3A 98.909 275 3 0 2285 2559 689524697 689524971 2.290000e-135 492
12 TraesCS3A01G451500 chr3A 86.245 458 54 5 1955 2404 686278647 686278191 2.960000e-134 488
13 TraesCS3A01G451500 chr3A 97.112 277 7 1 1 276 689657701 689657977 1.390000e-127 466
14 TraesCS3A01G451500 chr3A 96.751 277 8 1 1 276 689651665 689651941 6.450000e-126 460
15 TraesCS3A01G451500 chr3A 94.585 277 14 1 1 276 689781526 689781802 6.540000e-116 427
16 TraesCS3A01G451500 chr3D 90.729 1262 97 10 376 1624 553357146 553358400 0.000000e+00 1664
17 TraesCS3A01G451500 chr3D 85.970 948 100 14 712 1627 553405894 553406840 0.000000e+00 983
18 TraesCS3A01G451500 chr3D 94.794 461 20 2 1943 2399 553362093 553362553 0.000000e+00 715
19 TraesCS3A01G451500 chr3D 90.835 491 38 6 277 763 548999983 548999496 0.000000e+00 651
20 TraesCS3A01G451500 chr3D 86.248 509 61 8 1901 2404 548987847 548987343 6.230000e-151 544
21 TraesCS3A01G451500 chr3D 95.307 277 12 1 1 276 553355590 553355866 3.020000e-119 438
22 TraesCS3A01G451500 chr3D 84.718 301 35 6 1331 1627 548999104 548998811 8.960000e-75 291
23 TraesCS3A01G451500 chr3D 95.181 166 7 1 2395 2559 553372169 553372334 7.020000e-66 261
24 TraesCS3A01G451500 chr3D 92.308 156 9 3 1624 1778 548998602 548998449 4.290000e-53 219
25 TraesCS3A01G451500 chr3D 90.076 131 4 5 1698 1827 553359000 553359122 7.330000e-36 161
26 TraesCS3A01G451500 chr3D 85.149 101 13 2 2453 2552 170176930 170176831 4.500000e-18 102
27 TraesCS3A01G451500 chr3B 87.479 583 62 9 1830 2404 728293607 728293028 0.000000e+00 662
28 TraesCS3A01G451500 chr3B 85.135 296 34 5 1331 1623 728294962 728294674 6.920000e-76 294
29 TraesCS3A01G451500 chr1A 87.273 275 28 7 7 276 253048346 253048074 8.890000e-80 307
30 TraesCS3A01G451500 chr1A 85.965 285 31 7 2 277 245123403 245123687 1.930000e-76 296
31 TraesCS3A01G451500 chr1A 88.095 84 10 0 2469 2552 215941757 215941674 1.620000e-17 100
32 TraesCS3A01G451500 chr7A 85.614 285 32 6 2 277 408694767 408695051 8.960000e-75 291
33 TraesCS3A01G451500 chr7D 85.211 284 33 6 3 277 368815100 368815383 1.500000e-72 283
34 TraesCS3A01G451500 chr7D 91.358 81 7 0 2469 2549 105222704 105222784 7.480000e-21 111
35 TraesCS3A01G451500 chr7D 90.123 81 8 0 2469 2549 294421074 294420994 3.480000e-19 106
36 TraesCS3A01G451500 chr2B 89.286 84 9 0 2469 2552 757859051 757859134 3.480000e-19 106
37 TraesCS3A01G451500 chr2A 90.123 81 8 0 2469 2549 16896446 16896526 3.480000e-19 106


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G451500 chr3A 689578151 689580709 2558 False 4726.0 4726 100.000000 1 2559 1 chr3A.!!$F1 2558
1 TraesCS3A01G451500 chr3A 689607929 689610487 2558 False 4549.0 4549 98.750000 1 2559 1 chr3A.!!$F2 2558
2 TraesCS3A01G451500 chr3A 689523296 689524971 1675 False 1447.5 2403 98.311000 277 2559 2 chr3A.!!$F6 2282
3 TraesCS3A01G451500 chr3A 689657701 689667576 9875 False 1209.0 1480 90.013250 1 1627 4 chr3A.!!$F7 1626
4 TraesCS3A01G451500 chr3A 689846868 689847664 796 False 789.0 789 84.944000 662 1438 1 chr3A.!!$F5 776
5 TraesCS3A01G451500 chr3A 689866848 689867978 1130 False 719.5 811 86.763500 376 1438 2 chr3A.!!$F8 1062
6 TraesCS3A01G451500 chr3A 686278191 686281530 3339 True 636.0 819 86.770333 277 2404 3 chr3A.!!$R1 2127
7 TraesCS3A01G451500 chr3D 553405894 553406840 946 False 983.0 983 85.970000 712 1627 1 chr3D.!!$F2 915
8 TraesCS3A01G451500 chr3D 553355590 553362553 6963 False 744.5 1664 92.726500 1 2399 4 chr3D.!!$F3 2398
9 TraesCS3A01G451500 chr3D 548987343 548987847 504 True 544.0 544 86.248000 1901 2404 1 chr3D.!!$R2 503
10 TraesCS3A01G451500 chr3D 548998449 548999983 1534 True 387.0 651 89.287000 277 1778 3 chr3D.!!$R3 1501
11 TraesCS3A01G451500 chr3B 728293028 728294962 1934 True 478.0 662 86.307000 1331 2404 2 chr3B.!!$R1 1073

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
592 2277 2.278332 AGAGCCAACAGAAGGTTTCC 57.722 50.0 0.0 0.0 37.72 3.13 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1848 8692 1.402852 GGCAAATTTTCTCGGGTGAGC 60.403 52.381 0.0 0.0 42.26 4.26 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
592 2277 2.278332 AGAGCCAACAGAAGGTTTCC 57.722 50.000 0.00 0.00 37.72 3.13
1003 5682 5.716228 ACTTATTTTGATCACTTGGCCATGA 59.284 36.000 24.48 18.07 0.00 3.07
1198 5882 1.411246 GTAGATGGTCGGGTATGCACA 59.589 52.381 0.00 0.00 0.00 4.57
1274 5958 1.528586 CCTGTCACAAAGAGCACTTCG 59.471 52.381 0.00 0.00 35.05 3.79
1313 5997 4.278170 CCACTAAGAAGACAATTGTTGGCA 59.722 41.667 13.36 0.00 42.71 4.92
1339 6023 2.029970 GCTCAACAAAGACAACGACGAA 59.970 45.455 0.00 0.00 0.00 3.85
1412 6108 0.039618 CAGTAAAGCCCCACCACCAT 59.960 55.000 0.00 0.00 0.00 3.55
1454 6150 2.358737 CACCGGGTGAACCTGAGC 60.359 66.667 22.77 0.00 45.36 4.26
1783 8563 4.273480 ACATGTAGCGTTATCCTTGAATGC 59.727 41.667 0.00 0.00 38.79 3.56
2250 11970 1.583054 GACGAGATTATGGTGGGTGC 58.417 55.000 0.00 0.00 0.00 5.01
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
592 2277 1.118838 TGTGCTTCCCCACCAAAAAG 58.881 50.000 0.00 0.00 34.85 2.27
1198 5882 4.650972 TTTGTACAACTTGCTAGGGGAT 57.349 40.909 8.07 0.00 0.00 3.85
1274 5958 2.221299 TGGCACAGTACCCACCCTC 61.221 63.158 0.00 0.00 0.00 4.30
1313 5997 3.876914 TCGTTGTCTTTGTTGAGCTCATT 59.123 39.130 19.04 0.00 0.00 2.57
1325 6009 5.541098 AAGAAGTTTTCGTCGTTGTCTTT 57.459 34.783 0.00 0.00 33.71 2.52
1339 6023 6.596497 TCTTAGGTCGTTTGTGAAAGAAGTTT 59.404 34.615 0.00 0.00 0.00 2.66
1454 6150 3.465871 GCTTCTTCTTAGGATCTGGCAG 58.534 50.000 8.58 8.58 0.00 4.85
1783 8563 3.391665 GAGCGTGGGTGGGATGGAG 62.392 68.421 0.00 0.00 0.00 3.86
1848 8692 1.402852 GGCAAATTTTCTCGGGTGAGC 60.403 52.381 0.00 0.00 42.26 4.26
2250 11970 2.406616 CCCCCACGCTTCAAATCGG 61.407 63.158 0.00 0.00 0.00 4.18


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.