Multiple sequence alignment - TraesCS3A01G443300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G443300 chr3A 100.000 2438 0 0 1 2438 684765867 684768304 0 4503
1 TraesCS3A01G443300 chr6A 97.264 2449 49 3 1 2432 21703450 21701003 0 4135
2 TraesCS3A01G443300 chr6A 95.558 2454 91 3 1 2437 124893060 124895512 0 3912
3 TraesCS3A01G443300 chr6A 96.267 1902 50 6 547 2431 9065903 9067800 0 3099
4 TraesCS3A01G443300 chr6D 96.162 2449 76 3 1 2432 201581278 201578831 0 3986
5 TraesCS3A01G443300 chr4B 96.072 2444 78 3 1 2427 4206657 4209099 0 3965
6 TraesCS3A01G443300 chr7B 95.438 2455 91 6 1 2436 630557628 630555176 0 3893
7 TraesCS3A01G443300 chr7B 96.762 2131 50 4 315 2427 490895051 490892922 0 3535
8 TraesCS3A01G443300 chr6B 95.499 2444 91 4 1 2427 230627145 230629586 0 3886
9 TraesCS3A01G443300 chr6B 95.213 2110 82 3 1 2091 601117451 601115342 0 3319
10 TraesCS3A01G443300 chr6B 95.464 1962 71 3 488 2432 136800487 136802447 0 3114
11 TraesCS3A01G443300 chr7D 95.180 2448 99 4 1 2431 36903931 36906376 0 3849
12 TraesCS3A01G443300 chr3B 95.094 2446 101 4 1 2427 444681563 444679118 0 3834
13 TraesCS3A01G443300 chr5A 96.782 1709 36 4 741 2432 384442877 384444583 0 2833
14 TraesCS3A01G443300 chr2A 96.494 599 20 1 1829 2427 266509499 266510096 0 989


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G443300 chr3A 684765867 684768304 2437 False 4503 4503 100.000 1 2438 1 chr3A.!!$F1 2437
1 TraesCS3A01G443300 chr6A 21701003 21703450 2447 True 4135 4135 97.264 1 2432 1 chr6A.!!$R1 2431
2 TraesCS3A01G443300 chr6A 124893060 124895512 2452 False 3912 3912 95.558 1 2437 1 chr6A.!!$F2 2436
3 TraesCS3A01G443300 chr6A 9065903 9067800 1897 False 3099 3099 96.267 547 2431 1 chr6A.!!$F1 1884
4 TraesCS3A01G443300 chr6D 201578831 201581278 2447 True 3986 3986 96.162 1 2432 1 chr6D.!!$R1 2431
5 TraesCS3A01G443300 chr4B 4206657 4209099 2442 False 3965 3965 96.072 1 2427 1 chr4B.!!$F1 2426
6 TraesCS3A01G443300 chr7B 630555176 630557628 2452 True 3893 3893 95.438 1 2436 1 chr7B.!!$R2 2435
7 TraesCS3A01G443300 chr7B 490892922 490895051 2129 True 3535 3535 96.762 315 2427 1 chr7B.!!$R1 2112
8 TraesCS3A01G443300 chr6B 230627145 230629586 2441 False 3886 3886 95.499 1 2427 1 chr6B.!!$F2 2426
9 TraesCS3A01G443300 chr6B 601115342 601117451 2109 True 3319 3319 95.213 1 2091 1 chr6B.!!$R1 2090
10 TraesCS3A01G443300 chr6B 136800487 136802447 1960 False 3114 3114 95.464 488 2432 1 chr6B.!!$F1 1944
11 TraesCS3A01G443300 chr7D 36903931 36906376 2445 False 3849 3849 95.180 1 2431 1 chr7D.!!$F1 2430
12 TraesCS3A01G443300 chr3B 444679118 444681563 2445 True 3834 3834 95.094 1 2427 1 chr3B.!!$R1 2426
13 TraesCS3A01G443300 chr5A 384442877 384444583 1706 False 2833 2833 96.782 741 2432 1 chr5A.!!$F1 1691
14 TraesCS3A01G443300 chr2A 266509499 266510096 597 False 989 989 96.494 1829 2427 1 chr2A.!!$F1 598

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
945 948 1.541233 CGACTGAGCAGTTGGAAAGGT 60.541 52.381 9.55 0.0 42.66 3.5 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2199 2223 1.078497 CGGAGGTTATGCTGCCACA 60.078 57.895 0.0 0.0 0.0 4.17 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
438 439 6.429385 GCCAATGGATCCAAAATTTTGTAACA 59.571 34.615 25.25 18.77 36.45 2.41
659 662 3.130280 TCTGCAATATGCCGATGACAT 57.870 42.857 0.00 0.00 44.23 3.06
945 948 1.541233 CGACTGAGCAGTTGGAAAGGT 60.541 52.381 9.55 0.00 42.66 3.50
1194 1197 0.694771 TGCAGGTCAAGAATGAGGCT 59.305 50.000 0.00 0.00 35.88 4.58
1370 1373 3.982576 TCTTTTTCGCTTTGGGTCTTC 57.017 42.857 0.00 0.00 0.00 2.87
1692 1695 1.872237 GCGCTTATGCATTCCGAGGTA 60.872 52.381 3.54 0.00 39.64 3.08
1789 1792 2.091555 AGGGGAGTTGTGCTAACCAAAA 60.092 45.455 0.00 0.00 0.00 2.44
1827 1830 2.814336 CAACTGGCCAGGAAGTAAGAAC 59.186 50.000 35.42 0.00 0.00 3.01
2023 2045 2.596904 TACTATGGTCGCTTTGGCTC 57.403 50.000 0.00 0.00 36.09 4.70
2260 2285 1.346395 ACATAGGCAAAGTGTCGGTCA 59.654 47.619 0.00 0.00 0.00 4.02
2427 2452 9.543018 GATAATAAAATCGCCCTTTATCGAAAG 57.457 33.333 0.00 0.00 41.61 2.62
2433 2458 5.291293 TCGCCCTTTATCGAAAGAAAAAG 57.709 39.130 0.00 0.74 44.23 2.27
2437 2462 6.129194 CGCCCTTTATCGAAAGAAAAAGTTTG 60.129 38.462 0.00 0.00 44.23 2.93
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
73 74 1.160137 GGCAACAAGACAATCTCGCT 58.840 50.000 0.00 0.0 0.00 4.93
438 439 0.252696 TGATGGCCACACTACCTCCT 60.253 55.000 8.16 0.0 0.00 3.69
659 662 8.748412 CCAGGTCATGTTCCATAAAAAGAATTA 58.252 33.333 11.03 0.0 0.00 1.40
945 948 3.006967 GTCCTCCAACTGAGAGCAACTTA 59.993 47.826 0.00 0.0 44.42 2.24
1068 1071 1.821136 CCCTGCCAAAAGAATCTGGAC 59.179 52.381 0.00 0.0 34.35 4.02
1194 1197 9.841295 AGTTTGAACAACCATTTACTAAGTAGA 57.159 29.630 0.00 0.0 0.00 2.59
1370 1373 0.105964 TGACCCATCCTTTATCGCGG 59.894 55.000 6.13 0.0 0.00 6.46
1531 1534 1.314518 GGGGGCCAATCAAATCCCT 59.685 57.895 4.39 0.0 38.78 4.20
1789 1792 2.255252 GCGCCGTGCAAGATTGTT 59.745 55.556 0.00 0.0 45.45 2.83
1827 1830 3.393800 AGGTGTTTGATTGTCTCGTCAG 58.606 45.455 0.00 0.0 0.00 3.51
2199 2223 1.078497 CGGAGGTTATGCTGCCACA 60.078 57.895 0.00 0.0 0.00 4.17
2260 2285 7.122353 ACAATACGACAACAGTAGAGTCCTATT 59.878 37.037 0.00 0.0 29.61 1.73


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.