Multiple sequence alignment - TraesCS3A01G431900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G431900 chr3A 100.000 2336 0 0 1 2336 672914410 672916745 0.000000e+00 4314
1 TraesCS3A01G431900 chr3A 96.863 1785 41 11 561 2335 692573172 692571393 0.000000e+00 2972
2 TraesCS3A01G431900 chr3A 95.833 360 13 1 144 503 471793340 471792983 4.330000e-162 580
3 TraesCS3A01G431900 chr5D 98.127 2349 29 9 1 2335 560880400 560878053 0.000000e+00 4080
4 TraesCS3A01G431900 chr5D 96.678 2348 30 12 1 2335 503213805 503211493 0.000000e+00 3860
5 TraesCS3A01G431900 chrUn 98.043 2350 31 8 1 2335 93416415 93418764 0.000000e+00 4071
6 TraesCS3A01G431900 chr3B 97.617 2350 37 12 1 2335 201522605 201520260 0.000000e+00 4012
7 TraesCS3A01G431900 chr6A 96.886 2344 55 9 1 2335 271185370 271183036 0.000000e+00 3908
8 TraesCS3A01G431900 chr2D 97.948 2193 32 7 1 2180 272798303 272800495 0.000000e+00 3788
9 TraesCS3A01G431900 chr1A 95.899 2341 75 13 1 2333 168442699 168445026 0.000000e+00 3771
10 TraesCS3A01G431900 chr4A 96.894 1835 39 9 127 1950 722779092 722780919 0.000000e+00 3057
11 TraesCS3A01G431900 chr2A 89.247 186 17 2 16 201 651278124 651277942 1.810000e-56 230
12 TraesCS3A01G431900 chr2A 96.721 122 4 0 339 460 187105848 187105969 1.090000e-48 204


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G431900 chr3A 672914410 672916745 2335 False 4314 4314 100.000 1 2336 1 chr3A.!!$F1 2335
1 TraesCS3A01G431900 chr3A 692571393 692573172 1779 True 2972 2972 96.863 561 2335 1 chr3A.!!$R2 1774
2 TraesCS3A01G431900 chr5D 560878053 560880400 2347 True 4080 4080 98.127 1 2335 1 chr5D.!!$R2 2334
3 TraesCS3A01G431900 chr5D 503211493 503213805 2312 True 3860 3860 96.678 1 2335 1 chr5D.!!$R1 2334
4 TraesCS3A01G431900 chrUn 93416415 93418764 2349 False 4071 4071 98.043 1 2335 1 chrUn.!!$F1 2334
5 TraesCS3A01G431900 chr3B 201520260 201522605 2345 True 4012 4012 97.617 1 2335 1 chr3B.!!$R1 2334
6 TraesCS3A01G431900 chr6A 271183036 271185370 2334 True 3908 3908 96.886 1 2335 1 chr6A.!!$R1 2334
7 TraesCS3A01G431900 chr2D 272798303 272800495 2192 False 3788 3788 97.948 1 2180 1 chr2D.!!$F1 2179
8 TraesCS3A01G431900 chr1A 168442699 168445026 2327 False 3771 3771 95.899 1 2333 1 chr1A.!!$F1 2332
9 TraesCS3A01G431900 chr4A 722779092 722780919 1827 False 3057 3057 96.894 127 1950 1 chr4A.!!$F1 1823

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
297 298 4.000988 GCAATCCAAAAGGAACTCGAGTA 58.999 43.478 20.39 0.0 38.49 2.59 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2000 2039 3.386486 CTCGTTGCAAACCTACTGTACA 58.614 45.455 0.0 0.0 46.28 2.9 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
297 298 4.000988 GCAATCCAAAAGGAACTCGAGTA 58.999 43.478 20.39 0.0 38.49 2.59
360 362 6.775594 ACCAAAATACTTTCATTAGCTCCC 57.224 37.500 0.00 0.0 0.00 4.30
1174 1194 9.001542 GGTCTAGTTCTATACGAATACTGATGT 57.998 37.037 0.00 0.0 33.45 3.06
1185 1205 4.040461 CGAATACTGATGTGGGATAGGGTT 59.960 45.833 0.00 0.0 0.00 4.11
1543 1574 7.254932 GCTCTAATCCGAAGCATAAACAAAGAT 60.255 37.037 0.00 0.0 0.00 2.40
1778 1817 5.432885 AATTGGTTCACGTAAGAAAGTGG 57.567 39.130 0.00 0.0 43.62 4.00
2335 2375 5.031066 AGTAAGCGCCTTTATTATGGTCA 57.969 39.130 2.29 0.0 0.00 4.02
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
346 348 9.706691 TTATAATACTTCGGGAGCTAATGAAAG 57.293 33.333 0.00 0.0 0.00 2.62
610 625 8.328864 CCTCTCGTAGAAGTATTTTAACAATGC 58.671 37.037 0.00 0.0 34.09 3.56
1067 1087 0.551377 TCCATTGGGTAGGGCTTCCA 60.551 55.000 2.09 0.0 34.93 3.53
1095 1115 2.094182 GGTGTCATTCTCTAGCCGAACA 60.094 50.000 0.00 0.0 0.00 3.18
1174 1194 8.395605 ACTTACTTCAATTTTAACCCTATCCCA 58.604 33.333 0.00 0.0 0.00 4.37
1361 1389 9.436957 TCTCTTCGCTTGAATTTAAGAACTTAT 57.563 29.630 13.77 0.0 0.00 1.73
1433 1464 9.477484 GAACGGAAGCTCTTATTTTCATATCTA 57.523 33.333 0.00 0.0 0.00 1.98
1435 1466 8.142994 TGAACGGAAGCTCTTATTTTCATATC 57.857 34.615 0.00 0.0 0.00 1.63
1543 1574 7.455891 AGTTCTTTTTCGAAAGATTACCCCTA 58.544 34.615 10.98 0.0 41.60 3.53
1778 1817 4.877251 TGCATTCCTACGTAAACCAATACC 59.123 41.667 0.00 0.0 0.00 2.73
2000 2039 3.386486 CTCGTTGCAAACCTACTGTACA 58.614 45.455 0.00 0.0 46.28 2.90
2156 2196 8.211629 AGCGGGTTAATTCTTTTATAGACATCT 58.788 33.333 0.00 0.0 30.90 2.90
2159 2199 8.570068 AAAGCGGGTTAATTCTTTTATAGACA 57.430 30.769 0.00 0.0 30.90 3.41
2164 2204 7.892609 AGTTGAAAGCGGGTTAATTCTTTTAT 58.107 30.769 0.00 0.0 0.00 1.40


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.