Multiple sequence alignment - TraesCS3A01G431800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G431800 chr3A 100.000 2411 0 0 1 2411 672913920 672916330 0 4453
1 TraesCS3A01G431800 chr5D 97.657 2433 35 11 1 2411 560880898 560878466 0 4157
2 TraesCS3A01G431800 chrUn 97.577 2435 35 11 1 2411 93415916 93418350 0 4148
3 TraesCS3A01G431800 chrUn 97.668 1415 20 7 1010 2411 327660468 327661882 0 2418
4 TraesCS3A01G431800 chr2D 97.451 2432 41 9 1 2411 272797805 272800236 0 4128
5 TraesCS3A01G431800 chr3B 97.404 2427 43 13 1 2411 201523096 201520674 0 4115
6 TraesCS3A01G431800 chr6A 96.860 2420 57 10 1 2411 271185859 271183450 0 4030
7 TraesCS3A01G431800 chr1A 95.535 2419 86 13 1 2411 168442211 168444615 0 3849
8 TraesCS3A01G431800 chr7B 95.177 2426 78 16 1 2411 559141407 559139006 0 3795
9 TraesCS3A01G431800 chr4A 96.899 1806 38 9 617 2411 722779092 722780890 0 3009
10 TraesCS3A01G431800 chr2B 96.262 1712 57 6 1 1708 369624132 369622424 0 2800


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G431800 chr3A 672913920 672916330 2410 False 4453 4453 100.000 1 2411 1 chr3A.!!$F1 2410
1 TraesCS3A01G431800 chr5D 560878466 560880898 2432 True 4157 4157 97.657 1 2411 1 chr5D.!!$R1 2410
2 TraesCS3A01G431800 chrUn 93415916 93418350 2434 False 4148 4148 97.577 1 2411 1 chrUn.!!$F1 2410
3 TraesCS3A01G431800 chrUn 327660468 327661882 1414 False 2418 2418 97.668 1010 2411 1 chrUn.!!$F2 1401
4 TraesCS3A01G431800 chr2D 272797805 272800236 2431 False 4128 4128 97.451 1 2411 1 chr2D.!!$F1 2410
5 TraesCS3A01G431800 chr3B 201520674 201523096 2422 True 4115 4115 97.404 1 2411 1 chr3B.!!$R1 2410
6 TraesCS3A01G431800 chr6A 271183450 271185859 2409 True 4030 4030 96.860 1 2411 1 chr6A.!!$R1 2410
7 TraesCS3A01G431800 chr1A 168442211 168444615 2404 False 3849 3849 95.535 1 2411 1 chr1A.!!$F1 2410
8 TraesCS3A01G431800 chr7B 559139006 559141407 2401 True 3795 3795 95.177 1 2411 1 chr7B.!!$R1 2410
9 TraesCS3A01G431800 chr4A 722779092 722780890 1798 False 3009 3009 96.899 617 2411 1 chr4A.!!$F1 1794
10 TraesCS3A01G431800 chr2B 369622424 369624132 1708 True 2800 2800 96.262 1 1708 1 chr2B.!!$R1 1707

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
112 121 1.335142 GGATCACGGCGAGACAGATAC 60.335 57.143 16.62 5.73 0.0 2.24 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1970 2016 0.172578 CCACGCCTACGAATCAGTCA 59.827 55.0 0.0 0.0 43.93 3.41 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
112 121 1.335142 GGATCACGGCGAGACAGATAC 60.335 57.143 16.62 5.73 0.00 2.24
188 197 5.351458 GGTACGTATATTTCCCGACAAACT 58.649 41.667 0.00 0.00 0.00 2.66
218 227 2.521105 AGACCCACAGAAACACGTAC 57.479 50.000 0.00 0.00 0.00 3.67
266 275 7.797038 GATATTGGGTATCCGTTGTTAAACT 57.203 36.000 0.00 0.00 34.34 2.66
431 443 4.415881 AAATGCCCGGTTTTTCTTTCTT 57.584 36.364 0.00 0.00 0.00 2.52
787 806 4.000988 GCAATCCAAAAGGAACTCGAGTA 58.999 43.478 20.39 0.00 38.49 2.59
850 870 6.775594 ACCAAAATACTTTCATTAGCTCCC 57.224 37.500 0.00 0.00 0.00 4.30
1664 1703 9.001542 GGTCTAGTTCTATACGAATACTGATGT 57.998 37.037 0.00 0.00 33.45 3.06
1675 1714 4.040461 CGAATACTGATGTGGGATAGGGTT 59.960 45.833 0.00 0.00 0.00 4.11
1950 1996 7.987458 AGATATGAAAATAAGAGCTTCCGTTCA 59.013 33.333 0.00 0.00 0.00 3.18
2033 2079 7.254932 GCTCTAATCCGAAGCATAAACAAAGAT 60.255 37.037 0.00 0.00 0.00 2.40
2268 2320 5.432885 AATTGGTTCACGTAAGAAAGTGG 57.567 39.130 0.00 0.00 43.62 4.00
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
112 121 1.446907 ATTGCTCTTCGTCCTGCTTG 58.553 50.000 0.00 0.0 0.00 4.01
188 197 3.578978 TCTGTGGGTCTTAGTGTAACCA 58.421 45.455 0.00 0.0 37.80 3.67
242 251 7.797038 AGTTTAACAACGGATACCCAATATC 57.203 36.000 0.00 0.0 39.31 1.63
266 275 6.768861 CCCCATTTCATAAAGTATACGACCAA 59.231 38.462 0.00 0.0 0.00 3.67
836 856 9.706691 TTATAATACTTCGGGAGCTAATGAAAG 57.293 33.333 0.00 0.0 0.00 2.62
1100 1131 8.328864 CCTCTCGTAGAAGTATTTTAACAATGC 58.671 37.037 0.00 0.0 34.09 3.56
1557 1596 0.551377 TCCATTGGGTAGGGCTTCCA 60.551 55.000 2.09 0.0 34.93 3.53
1585 1624 2.094182 GGTGTCATTCTCTAGCCGAACA 60.094 50.000 0.00 0.0 0.00 3.18
1664 1703 8.395605 ACTTACTTCAATTTTAACCCTATCCCA 58.604 33.333 0.00 0.0 0.00 4.37
1851 1896 9.436957 TCTCTTCGCTTGAATTTAAGAACTTAT 57.563 29.630 13.77 0.0 0.00 1.73
1923 1969 9.477484 GAACGGAAGCTCTTATTTTCATATCTA 57.523 33.333 0.00 0.0 0.00 1.98
1925 1971 8.142994 TGAACGGAAGCTCTTATTTTCATATC 57.857 34.615 0.00 0.0 0.00 1.63
1970 2016 0.172578 CCACGCCTACGAATCAGTCA 59.827 55.000 0.00 0.0 43.93 3.41
2033 2079 7.455891 AGTTCTTTTTCGAAAGATTACCCCTA 58.544 34.615 10.98 0.0 41.60 3.53
2268 2320 4.877251 TGCATTCCTACGTAAACCAATACC 59.123 41.667 0.00 0.0 0.00 2.73


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.