Multiple sequence alignment - TraesCS3A01G431700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G431700 chr3A 100.000 2372 0 0 1 2372 672913411 672915782 0.000000e+00 4381
1 TraesCS3A01G431700 chr5D 97.575 2392 38 9 1 2372 560881408 560879017 0.000000e+00 4078
2 TraesCS3A01G431700 chr5D 96.774 2139 48 8 1 2136 329123507 329125627 0.000000e+00 3548
3 TraesCS3A01G431700 chr3B 97.443 2386 45 9 1 2372 201523606 201521223 0.000000e+00 4054
4 TraesCS3A01G431700 chr2D 97.402 2386 42 9 1 2369 272797298 272799680 0.000000e+00 4045
5 TraesCS3A01G431700 chr6A 96.639 2380 64 7 1 2372 271186369 271183998 0.000000e+00 3938
6 TraesCS3A01G431700 chr4D 95.698 2394 73 12 1 2372 19925395 19923010 0.000000e+00 3823
7 TraesCS3A01G431700 chr7B 96.037 2271 66 11 58 2314 559141856 559139596 0.000000e+00 3674
8 TraesCS3A01G431700 chr7B 92.941 85 1 1 2290 2369 559139638 559139554 4.140000e-23 119
9 TraesCS3A01G431700 chr2B 96.400 2222 72 7 1 2217 369624642 369622424 0.000000e+00 3653
10 TraesCS3A01G431700 chr1A 95.737 2041 67 11 336 2369 168442037 168444064 0.000000e+00 3269
11 TraesCS3A01G431700 chr1A 97.645 1571 31 4 1 1569 584780040 584778474 0.000000e+00 2691
12 TraesCS3A01G431700 chr6B 91.176 102 3 1 2277 2372 420839924 420839823 1.480000e-27 134


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G431700 chr3A 672913411 672915782 2371 False 4381.0 4381 100.000 1 2372 1 chr3A.!!$F1 2371
1 TraesCS3A01G431700 chr5D 560879017 560881408 2391 True 4078.0 4078 97.575 1 2372 1 chr5D.!!$R1 2371
2 TraesCS3A01G431700 chr5D 329123507 329125627 2120 False 3548.0 3548 96.774 1 2136 1 chr5D.!!$F1 2135
3 TraesCS3A01G431700 chr3B 201521223 201523606 2383 True 4054.0 4054 97.443 1 2372 1 chr3B.!!$R1 2371
4 TraesCS3A01G431700 chr2D 272797298 272799680 2382 False 4045.0 4045 97.402 1 2369 1 chr2D.!!$F1 2368
5 TraesCS3A01G431700 chr6A 271183998 271186369 2371 True 3938.0 3938 96.639 1 2372 1 chr6A.!!$R1 2371
6 TraesCS3A01G431700 chr4D 19923010 19925395 2385 True 3823.0 3823 95.698 1 2372 1 chr4D.!!$R1 2371
7 TraesCS3A01G431700 chr7B 559139554 559141856 2302 True 1896.5 3674 94.489 58 2369 2 chr7B.!!$R1 2311
8 TraesCS3A01G431700 chr2B 369622424 369624642 2218 True 3653.0 3653 96.400 1 2217 1 chr2B.!!$R1 2216
9 TraesCS3A01G431700 chr1A 168442037 168444064 2027 False 3269.0 3269 95.737 336 2369 1 chr1A.!!$F1 2033
10 TraesCS3A01G431700 chr1A 584778474 584780040 1566 True 2691.0 2691 97.645 1 1569 1 chr1A.!!$R1 1568

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
621 635 1.335142 GGATCACGGCGAGACAGATAC 60.335 57.143 16.62 5.73 0.0 2.24 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2066 2124 0.551377 TCCATTGGGTAGGGCTTCCA 60.551 55.0 2.09 0.0 34.93 3.53 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
113 114 6.640518 AGACAGGAAAGAGTAAATATTCGCA 58.359 36.000 0.00 0.00 0.00 5.10
133 134 5.005875 TCGCACGCGAAATTCTTATTGAATA 59.994 36.000 15.93 0.00 46.01 1.75
158 159 8.603242 AAGAATACTTTACCGCGATTCAATAT 57.397 30.769 8.23 0.00 31.71 1.28
166 167 5.652744 ACCGCGATTCAATATGAGTAAAC 57.347 39.130 8.23 0.00 0.00 2.01
506 512 7.201617 CGACTATAACCCAAAAGAACCAGATTC 60.202 40.741 0.00 0.00 37.62 2.52
621 635 1.335142 GGATCACGGCGAGACAGATAC 60.335 57.143 16.62 5.73 0.00 2.24
727 741 2.521105 AGACCCACAGAAACACGTAC 57.479 50.000 0.00 0.00 0.00 3.67
775 789 7.797038 GATATTGGGTATCCGTTGTTAAACT 57.203 36.000 0.00 0.00 34.34 2.66
940 957 4.415881 AAATGCCCGGTTTTTCTTTCTT 57.584 36.364 0.00 0.00 0.00 2.52
1296 1327 4.000988 GCAATCCAAAAGGAACTCGAGTA 58.999 43.478 20.39 0.00 38.49 2.59
1359 1390 6.775594 ACCAAAATACTTTCATTAGCTCCC 57.224 37.500 0.00 0.00 0.00 4.30
2173 2231 9.001542 GGTCTAGTTCTATACGAATACTGATGT 57.998 37.037 0.00 0.00 33.45 3.06
2184 2242 4.040461 CGAATACTGATGTGGGATAGGGTT 59.960 45.833 0.00 0.00 0.00 4.11
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
133 134 6.920569 ATTGAATCGCGGTAAAGTATTCTT 57.079 33.333 6.13 0.0 35.14 2.52
506 512 3.334691 TCTTCCTCTATGTTGTTTGCGG 58.665 45.455 0.00 0.0 0.00 5.69
621 635 1.446907 ATTGCTCTTCGTCCTGCTTG 58.553 50.000 0.00 0.0 0.00 4.01
751 765 7.797038 AGTTTAACAACGGATACCCAATATC 57.203 36.000 0.00 0.0 39.31 1.63
775 789 6.768861 CCCCATTTCATAAAGTATACGACCAA 59.231 38.462 0.00 0.0 0.00 3.67
1345 1376 9.706691 TTATAATACTTCGGGAGCTAATGAAAG 57.293 33.333 0.00 0.0 0.00 2.62
1609 1646 8.328864 CCTCTCGTAGAAGTATTTTAACAATGC 58.671 37.037 0.00 0.0 34.09 3.56
2066 2124 0.551377 TCCATTGGGTAGGGCTTCCA 60.551 55.000 2.09 0.0 34.93 3.53
2094 2152 2.094182 GGTGTCATTCTCTAGCCGAACA 60.094 50.000 0.00 0.0 0.00 3.18
2173 2231 8.395605 ACTTACTTCAATTTTAACCCTATCCCA 58.604 33.333 0.00 0.0 0.00 4.37


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.