Multiple sequence alignment - TraesCS3A01G431600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G431600 chr3A 100.000 2450 0 0 1 2450 672910486 672912935 0.000000e+00 4525
1 TraesCS3A01G431600 chrUn 98.329 2454 34 7 1 2450 93410110 93412560 0.000000e+00 4298
2 TraesCS3A01G431600 chr2D 98.166 2454 37 8 1 2450 272794372 272796821 0.000000e+00 4276
3 TraesCS3A01G431600 chr5D 97.922 2454 42 8 1 2450 503217739 503215291 0.000000e+00 4241
4 TraesCS3A01G431600 chr5D 97.248 2362 54 10 93 2450 329120677 329123031 0.000000e+00 3991
5 TraesCS3A01G431600 chr6D 97.757 2452 47 6 1 2450 168251059 168248614 0.000000e+00 4217
6 TraesCS3A01G431600 chr6A 96.786 2458 63 11 1 2450 260116759 260119208 0.000000e+00 4087
7 TraesCS3A01G431600 chr7A 94.333 2453 124 13 1 2450 352182292 352184732 0.000000e+00 3746
8 TraesCS3A01G431600 chr2A 97.060 1769 45 7 576 2342 335829841 335828078 0.000000e+00 2972
9 TraesCS3A01G431600 chr2A 95.885 972 25 3 1 972 335838149 335837193 0.000000e+00 1559
10 TraesCS3A01G431600 chr2A 98.592 213 3 0 11 223 713027374 713027586 6.400000e-101 377
11 TraesCS3A01G431600 chr2A 94.574 129 5 2 548 676 588452219 588452093 5.340000e-47 198
12 TraesCS3A01G431600 chr2A 97.015 67 1 1 393 459 703332721 703332656 7.160000e-21 111
13 TraesCS3A01G431600 chr1D 95.216 1756 68 12 702 2450 397109208 397110954 0.000000e+00 2763


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G431600 chr3A 672910486 672912935 2449 False 4525 4525 100.000 1 2450 1 chr3A.!!$F1 2449
1 TraesCS3A01G431600 chrUn 93410110 93412560 2450 False 4298 4298 98.329 1 2450 1 chrUn.!!$F1 2449
2 TraesCS3A01G431600 chr2D 272794372 272796821 2449 False 4276 4276 98.166 1 2450 1 chr2D.!!$F1 2449
3 TraesCS3A01G431600 chr5D 503215291 503217739 2448 True 4241 4241 97.922 1 2450 1 chr5D.!!$R1 2449
4 TraesCS3A01G431600 chr5D 329120677 329123031 2354 False 3991 3991 97.248 93 2450 1 chr5D.!!$F1 2357
5 TraesCS3A01G431600 chr6D 168248614 168251059 2445 True 4217 4217 97.757 1 2450 1 chr6D.!!$R1 2449
6 TraesCS3A01G431600 chr6A 260116759 260119208 2449 False 4087 4087 96.786 1 2450 1 chr6A.!!$F1 2449
7 TraesCS3A01G431600 chr7A 352182292 352184732 2440 False 3746 3746 94.333 1 2450 1 chr7A.!!$F1 2449
8 TraesCS3A01G431600 chr2A 335828078 335829841 1763 True 2972 2972 97.060 576 2342 1 chr2A.!!$R1 1766
9 TraesCS3A01G431600 chr2A 335837193 335838149 956 True 1559 1559 95.885 1 972 1 chr2A.!!$R2 971
10 TraesCS3A01G431600 chr1D 397109208 397110954 1746 False 2763 2763 95.216 702 2450 1 chr1D.!!$F1 1748

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
522 524 0.832135 TCCGCCCCTTATCCAGCTAG 60.832 60.0 0.0 0.0 0.0 3.42 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2215 2235 8.528643 TCCGAAGACAAGATTACTTATTCTTCA 58.471 33.333 20.57 9.46 44.35 3.02 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
329 330 2.037251 TGCGCTTGGAAGAAGAACTAGT 59.963 45.455 9.73 0.00 0.00 2.57
380 382 3.281341 TCTTCGTCGCCGTAAGTAAAA 57.719 42.857 0.00 0.00 35.01 1.52
522 524 0.832135 TCCGCCCCTTATCCAGCTAG 60.832 60.000 0.00 0.00 0.00 3.42
620 623 7.315890 ACATAGAATGCCACTCTTTAAAAAGC 58.684 34.615 0.00 0.00 35.99 3.51
625 628 6.849588 ATGCCACTCTTTAAAAAGCAAAAG 57.150 33.333 0.00 0.00 35.99 2.27
648 652 2.899900 AGGAGTAATCAGCTGTGACACA 59.100 45.455 14.67 8.26 34.75 3.72
786 790 3.968045 TGGTTGGCCATACAATCGT 57.032 47.368 6.09 0.00 40.46 3.73
983 989 9.528489 AGATTCAAAATAAAGTAAAGGTAGGCA 57.472 29.630 0.00 0.00 0.00 4.75
1178 1184 5.463392 CACAAAGAGTTCTTGACGAGATTCA 59.537 40.000 0.00 0.00 36.12 2.57
1183 1189 3.322254 AGTTCTTGACGAGATTCACTGGT 59.678 43.478 0.00 0.00 40.12 4.00
2302 2325 5.365021 TTTTCCTGAAATCCCTGCAAAAA 57.635 34.783 0.00 0.00 0.00 1.94
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
164 165 2.091775 ACACTTAGATCCGGCTCTACCT 60.092 50.000 14.52 0.18 35.61 3.08
380 382 8.403236 GCAATTTTCCATATTCCTAGTTACGTT 58.597 33.333 0.00 0.00 0.00 3.99
620 623 5.702670 TCACAGCTGATTACTCCTTCTTTTG 59.297 40.000 23.35 1.80 0.00 2.44
625 628 3.929610 GTGTCACAGCTGATTACTCCTTC 59.070 47.826 23.35 0.00 0.00 3.46
655 659 5.972935 TGATGAGCTACAAAAGGATTCGTA 58.027 37.500 0.00 0.00 0.00 3.43
983 989 9.990868 AACTTGTCATAAATAAGGTTATTCCCT 57.009 29.630 0.00 0.00 36.75 4.20
1086 1092 6.104665 TCTCTCGAACTTAAGTAGACGATCA 58.895 40.000 22.74 15.53 36.40 2.92
1178 1184 3.893813 AGTTTCCTCGTAGTAACACCAGT 59.106 43.478 0.00 0.00 0.00 4.00
1183 1189 7.218228 TCATAACAGTTTCCTCGTAGTAACA 57.782 36.000 0.00 0.00 0.00 2.41
2215 2235 8.528643 TCCGAAGACAAGATTACTTATTCTTCA 58.471 33.333 20.57 9.46 44.35 3.02


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.