Multiple sequence alignment - TraesCS3A01G431400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G431400 chr3A 100.000 2250 0 0 1 2250 672909881 672912130 0.000000e+00 4156
1 TraesCS3A01G431400 chrUn 98.357 2252 32 5 1 2250 93409505 93411753 0.000000e+00 3949
2 TraesCS3A01G431400 chrUn 98.174 1807 30 3 1 1806 216518476 216520280 0.000000e+00 3151
3 TraesCS3A01G431400 chr5D 98.179 2251 37 4 1 2250 503218344 503216097 0.000000e+00 3927
4 TraesCS3A01G431400 chr2D 98.179 2252 36 5 1 2250 272793767 272796015 0.000000e+00 3927
5 TraesCS3A01G431400 chr6D 97.956 2251 41 4 1 2250 168251664 168249418 0.000000e+00 3897
6 TraesCS3A01G431400 chr6D 98.174 1807 30 3 1 1806 168255052 168253248 0.000000e+00 3151
7 TraesCS3A01G431400 chr3B 97.221 2267 42 8 1 2250 201527150 201524888 0.000000e+00 3818
8 TraesCS3A01G431400 chr3B 96.583 878 26 4 1373 2250 395369957 395369084 0.000000e+00 1452
9 TraesCS3A01G431400 chr6A 97.029 2255 56 7 1 2250 260116154 260118402 0.000000e+00 3783
10 TraesCS3A01G431400 chr5A 97.004 2003 57 3 1 2002 619266497 619264497 0.000000e+00 3363
11 TraesCS3A01G431400 chr2A 96.322 571 6 2 1577 2132 726910483 726911053 0.000000e+00 924
12 TraesCS3A01G431400 chr2A 91.753 194 6 6 2057 2249 581940296 581940112 6.160000e-66 261
13 TraesCS3A01G431400 chr2A 100.000 98 0 0 2130 2227 588451379 588451476 4.940000e-42 182


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G431400 chr3A 672909881 672912130 2249 False 4156 4156 100.000 1 2250 1 chr3A.!!$F1 2249
1 TraesCS3A01G431400 chrUn 93409505 93411753 2248 False 3949 3949 98.357 1 2250 1 chrUn.!!$F1 2249
2 TraesCS3A01G431400 chrUn 216518476 216520280 1804 False 3151 3151 98.174 1 1806 1 chrUn.!!$F2 1805
3 TraesCS3A01G431400 chr5D 503216097 503218344 2247 True 3927 3927 98.179 1 2250 1 chr5D.!!$R1 2249
4 TraesCS3A01G431400 chr2D 272793767 272796015 2248 False 3927 3927 98.179 1 2250 1 chr2D.!!$F1 2249
5 TraesCS3A01G431400 chr6D 168249418 168255052 5634 True 3524 3897 98.065 1 2250 2 chr6D.!!$R1 2249
6 TraesCS3A01G431400 chr3B 201524888 201527150 2262 True 3818 3818 97.221 1 2250 1 chr3B.!!$R1 2249
7 TraesCS3A01G431400 chr3B 395369084 395369957 873 True 1452 1452 96.583 1373 2250 1 chr3B.!!$R2 877
8 TraesCS3A01G431400 chr6A 260116154 260118402 2248 False 3783 3783 97.029 1 2250 1 chr6A.!!$F1 2249
9 TraesCS3A01G431400 chr5A 619264497 619266497 2000 True 3363 3363 97.004 1 2002 1 chr5A.!!$R1 2001
10 TraesCS3A01G431400 chr2A 726910483 726911053 570 False 924 924 96.322 1577 2132 1 chr2A.!!$F2 555

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
144 145 0.817654 AGCGCCCCTTATTTCAAAGC 59.182 50.0 2.29 0.0 0.0 3.51 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1783 5175 3.893813 AGTTTCCTCGTAGTAACACCAGT 59.106 43.478 0.0 0.0 0.0 4.0 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
135 136 3.319441 GAACCGGAAGCGCCCCTTA 62.319 63.158 9.46 0.00 32.78 2.69
144 145 0.817654 AGCGCCCCTTATTTCAAAGC 59.182 50.000 2.29 0.00 0.00 3.51
197 198 3.565307 TGGTCAGAGGCAAATTGAAAGT 58.435 40.909 0.00 0.00 0.00 2.66
380 381 3.452755 TCATAACATGAGCGATTCGGT 57.547 42.857 11.02 11.02 41.33 4.69
934 935 2.037251 TGCGCTTGGAAGAAGAACTAGT 59.963 45.455 9.73 0.00 0.00 2.57
942 943 7.444487 GCTTGGAAGAAGAACTAGTAAAAGGAA 59.556 37.037 0.00 0.00 0.00 3.36
985 986 3.281341 TCTTCGTCGCCGTAAGTAAAA 57.719 42.857 0.00 0.00 35.01 1.52
1127 1128 0.832135 TCCGCCCCTTATCCAGCTAG 60.832 60.000 0.00 0.00 0.00 3.42
1190 1192 3.898482 TCTGACCTCCATACTTCGATCA 58.102 45.455 0.00 0.00 0.00 2.92
1230 1233 6.849588 ATGCCACTCTTTAAAAAGCAAAAG 57.150 33.333 0.00 0.00 35.99 2.27
1253 1256 2.899900 AGGAGTAATCAGCTGTGACACA 59.100 45.455 14.67 8.26 34.75 3.72
1588 4980 9.528489 AGATTCAAAATAAAGTAAAGGTAGGCA 57.472 29.630 0.00 0.00 0.00 4.75
1783 5175 5.463392 CACAAAGAGTTCTTGACGAGATTCA 59.537 40.000 0.00 0.00 36.12 2.57
1788 5180 3.322254 AGTTCTTGACGAGATTCACTGGT 59.678 43.478 0.00 0.00 40.12 4.00
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
20 21 2.812591 CTGAACTCAATCACTTGCTGCT 59.187 45.455 0.00 0.00 32.11 4.24
135 136 1.676014 CCGTCCTCCTCGCTTTGAAAT 60.676 52.381 0.00 0.00 0.00 2.17
144 145 1.108776 TGAATAACCCGTCCTCCTCG 58.891 55.000 0.00 0.00 0.00 4.63
197 198 5.503002 GGGGTCTTAATTACCACTGCTTAA 58.497 41.667 8.85 0.00 37.44 1.85
769 770 2.091775 ACACTTAGATCCGGCTCTACCT 60.092 50.000 14.52 0.18 35.61 3.08
985 986 8.403236 GCAATTTTCCATATTCCTAGTTACGTT 58.597 33.333 0.00 0.00 0.00 3.99
1190 1192 6.845908 AGTGGCATTCTATGTCCAATATCTT 58.154 36.000 0.00 0.00 37.89 2.40
1230 1233 3.929610 GTGTCACAGCTGATTACTCCTTC 59.070 47.826 23.35 0.00 0.00 3.46
1260 1263 5.972935 TGATGAGCTACAAAAGGATTCGTA 58.027 37.500 0.00 0.00 0.00 3.43
1588 4980 9.990868 AACTTGTCATAAATAAGGTTATTCCCT 57.009 29.630 0.00 0.00 36.75 4.20
1691 5083 6.104665 TCTCTCGAACTTAAGTAGACGATCA 58.895 40.000 22.74 15.53 36.40 2.92
1783 5175 3.893813 AGTTTCCTCGTAGTAACACCAGT 59.106 43.478 0.00 0.00 0.00 4.00
1788 5180 7.218228 TCATAACAGTTTCCTCGTAGTAACA 57.782 36.000 0.00 0.00 0.00 2.41


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.