Multiple sequence alignment - TraesCS3A01G431300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G431300 chr3A 100.000 2468 0 0 1 2468 672909366 672911833 0 4558
1 TraesCS3A01G431300 chrUn 98.380 2469 36 4 1 2468 93408990 93411455 0 4335
2 TraesCS3A01G431300 chrUn 98.234 2322 38 3 1 2321 216517961 216520280 0 4058
3 TraesCS3A01G431300 chr5D 98.298 2468 40 2 1 2468 503218859 503216394 0 4324
4 TraesCS3A01G431300 chr2D 98.218 2469 41 3 1 2468 272793252 272795718 0 4313
5 TraesCS3A01G431300 chr3B 98.056 2469 44 4 1 2468 201527665 201525200 0 4290
6 TraesCS3A01G431300 chr3B 96.558 581 19 1 1888 2468 395369957 395369378 0 961
7 TraesCS3A01G431300 chr6A 97.409 2470 58 5 1 2468 260115639 260118104 0 4202
8 TraesCS3A01G431300 chr5A 96.962 2469 72 3 1 2468 619267012 619264546 0 4141
9 TraesCS3A01G431300 chr6D 98.363 2322 35 3 1 2321 168255567 168253248 0 4074
10 TraesCS3A01G431300 chr3D 98.231 2092 32 4 1 2092 589278903 589280989 0 3653


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G431300 chr3A 672909366 672911833 2467 False 4558 4558 100.000 1 2468 1 chr3A.!!$F1 2467
1 TraesCS3A01G431300 chrUn 93408990 93411455 2465 False 4335 4335 98.380 1 2468 1 chrUn.!!$F1 2467
2 TraesCS3A01G431300 chrUn 216517961 216520280 2319 False 4058 4058 98.234 1 2321 1 chrUn.!!$F2 2320
3 TraesCS3A01G431300 chr5D 503216394 503218859 2465 True 4324 4324 98.298 1 2468 1 chr5D.!!$R1 2467
4 TraesCS3A01G431300 chr2D 272793252 272795718 2466 False 4313 4313 98.218 1 2468 1 chr2D.!!$F1 2467
5 TraesCS3A01G431300 chr3B 201525200 201527665 2465 True 4290 4290 98.056 1 2468 1 chr3B.!!$R1 2467
6 TraesCS3A01G431300 chr3B 395369378 395369957 579 True 961 961 96.558 1888 2468 1 chr3B.!!$R2 580
7 TraesCS3A01G431300 chr6A 260115639 260118104 2465 False 4202 4202 97.409 1 2468 1 chr6A.!!$F1 2467
8 TraesCS3A01G431300 chr5A 619264546 619267012 2466 True 4141 4141 96.962 1 2468 1 chr5A.!!$R1 2467
9 TraesCS3A01G431300 chr6D 168253248 168255567 2319 True 4074 4074 98.363 1 2321 1 chr6D.!!$R1 2320
10 TraesCS3A01G431300 chr3D 589278903 589280989 2086 False 3653 3653 98.231 1 2092 1 chr3D.!!$F1 2091

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
659 660 0.817654 AGCGCCCCTTATTTCAAAGC 59.182 50.0 2.29 0.0 0.0 3.51 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2298 2306 3.893813 AGTTTCCTCGTAGTAACACCAGT 59.106 43.478 0.0 0.0 0.0 4.0 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
428 429 6.205853 AGTGCGGTTTGAACTATTGATTTACA 59.794 34.615 0.00 0.00 33.30 2.41
650 651 3.319441 GAACCGGAAGCGCCCCTTA 62.319 63.158 9.46 0.00 32.78 2.69
659 660 0.817654 AGCGCCCCTTATTTCAAAGC 59.182 50.000 2.29 0.00 0.00 3.51
712 713 3.565307 TGGTCAGAGGCAAATTGAAAGT 58.435 40.909 0.00 0.00 0.00 2.66
895 896 3.452755 TCATAACATGAGCGATTCGGT 57.547 42.857 11.02 11.02 41.33 4.69
1449 1451 2.037251 TGCGCTTGGAAGAAGAACTAGT 59.963 45.455 9.73 0.00 0.00 2.57
1500 1503 3.281341 TCTTCGTCGCCGTAAGTAAAA 57.719 42.857 0.00 0.00 35.01 1.52
1642 1645 0.832135 TCCGCCCCTTATCCAGCTAG 60.832 60.000 0.00 0.00 0.00 3.42
1705 1709 3.898482 TCTGACCTCCATACTTCGATCA 58.102 45.455 0.00 0.00 0.00 2.92
1745 1750 6.849588 ATGCCACTCTTTAAAAAGCAAAAG 57.150 33.333 0.00 0.00 35.99 2.27
1768 1773 2.899900 AGGAGTAATCAGCTGTGACACA 59.100 45.455 14.67 8.26 34.75 3.72
2103 2111 9.528489 AGATTCAAAATAAAGTAAAGGTAGGCA 57.472 29.630 0.00 0.00 0.00 4.75
2298 2306 5.463392 CACAAAGAGTTCTTGACGAGATTCA 59.537 40.000 0.00 0.00 36.12 2.57
2303 2311 3.322254 AGTTCTTGACGAGATTCACTGGT 59.678 43.478 0.00 0.00 40.12 4.00
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
455 456 5.100259 GTGATCGATTTCTAGGTTTCGTCA 58.900 41.667 0.00 8.49 33.52 4.35
535 536 2.812591 CTGAACTCAATCACTTGCTGCT 59.187 45.455 0.00 0.00 32.11 4.24
650 651 1.676014 CCGTCCTCCTCGCTTTGAAAT 60.676 52.381 0.00 0.00 0.00 2.17
659 660 1.108776 TGAATAACCCGTCCTCCTCG 58.891 55.000 0.00 0.00 0.00 4.63
712 713 5.503002 GGGGTCTTAATTACCACTGCTTAA 58.497 41.667 8.85 0.00 37.44 1.85
1284 1285 2.091775 ACACTTAGATCCGGCTCTACCT 60.092 50.000 14.52 0.18 35.61 3.08
1500 1503 8.403236 GCAATTTTCCATATTCCTAGTTACGTT 58.597 33.333 0.00 0.00 0.00 3.99
1705 1709 6.845908 AGTGGCATTCTATGTCCAATATCTT 58.154 36.000 0.00 0.00 37.89 2.40
1745 1750 3.929610 GTGTCACAGCTGATTACTCCTTC 59.070 47.826 23.35 0.00 0.00 3.46
1775 1780 5.972935 TGATGAGCTACAAAAGGATTCGTA 58.027 37.500 0.00 0.00 0.00 3.43
2103 2111 9.990868 AACTTGTCATAAATAAGGTTATTCCCT 57.009 29.630 0.00 0.00 36.75 4.20
2206 2214 6.104665 TCTCTCGAACTTAAGTAGACGATCA 58.895 40.000 22.74 15.53 36.40 2.92
2298 2306 3.893813 AGTTTCCTCGTAGTAACACCAGT 59.106 43.478 0.00 0.00 0.00 4.00
2303 2311 7.218228 TCATAACAGTTTCCTCGTAGTAACA 57.782 36.000 0.00 0.00 0.00 2.41


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.