Multiple sequence alignment - TraesCS3A01G431100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G431100 chr3A 100.000 2162 0 0 1 2162 672910518 672908357 0 3993
1 TraesCS3A01G431100 chr3B 98.659 2163 28 1 1 2162 201526513 201528675 0 3832
2 TraesCS3A01G431100 chr1A 98.659 2163 28 1 1 2162 554511737 554513899 0 3832
3 TraesCS3A01G431100 chr5D 98.613 2163 29 1 1 2162 503217707 503219869 0 3827
4 TraesCS3A01G431100 chr5D 98.289 2163 36 1 1 2162 503278737 503276575 0 3788
5 TraesCS3A01G431100 chr5D 98.104 2163 40 1 1 2162 6188429 6190591 0 3766
6 TraesCS3A01G431100 chr6D 98.428 2163 33 1 1 2162 168254415 168256577 0 3805
7 TraesCS3A01G431100 chr3D 98.382 2163 31 3 1 2162 589280053 589277894 0 3797


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G431100 chr3A 672908357 672910518 2161 True 3993 3993 100.000 1 2162 1 chr3A.!!$R1 2161
1 TraesCS3A01G431100 chr3B 201526513 201528675 2162 False 3832 3832 98.659 1 2162 1 chr3B.!!$F1 2161
2 TraesCS3A01G431100 chr1A 554511737 554513899 2162 False 3832 3832 98.659 1 2162 1 chr1A.!!$F1 2161
3 TraesCS3A01G431100 chr5D 503217707 503219869 2162 False 3827 3827 98.613 1 2162 1 chr5D.!!$F2 2161
4 TraesCS3A01G431100 chr5D 503276575 503278737 2162 True 3788 3788 98.289 1 2162 1 chr5D.!!$R1 2161
5 TraesCS3A01G431100 chr5D 6188429 6190591 2162 False 3766 3766 98.104 1 2162 1 chr5D.!!$F1 2161
6 TraesCS3A01G431100 chr6D 168254415 168256577 2162 False 3805 3805 98.428 1 2162 1 chr6D.!!$F1 2161
7 TraesCS3A01G431100 chr3D 589277894 589280053 2159 True 3797 3797 98.382 1 2162 1 chr3D.!!$R1 2161

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
493 494 1.108776 TGAATAACCCGTCCTCCTCG 58.891 55.0 0.0 0.0 0.0 4.63 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1663 1665 4.382901 GCATCCATGGCTGAATGGTTAAAA 60.383 41.667 19.76 0.0 46.24 1.52 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
440 441 5.503002 GGGGTCTTAATTACCACTGCTTAA 58.497 41.667 8.85 0.00 37.44 1.85
493 494 1.108776 TGAATAACCCGTCCTCCTCG 58.891 55.000 0.00 0.00 0.00 4.63
502 503 1.676014 CCGTCCTCCTCGCTTTGAAAT 60.676 52.381 0.00 0.00 0.00 2.17
617 618 2.812591 CTGAACTCAATCACTTGCTGCT 59.187 45.455 0.00 0.00 32.11 4.24
618 619 3.999001 CTGAACTCAATCACTTGCTGCTA 59.001 43.478 0.00 0.00 32.11 3.49
697 698 5.100259 GTGATCGATTTCTAGGTTTCGTCA 58.900 41.667 0.00 8.49 33.52 4.35
1033 1034 5.562635 TGGAATTACGACCTTTACCACAAT 58.437 37.500 0.00 0.00 0.00 2.71
1270 1272 9.508721 AATAGGTCCTATTCTTCTACCTTTTCT 57.491 33.333 17.17 0.00 40.89 2.52
1476 1478 5.953571 TCCTATGCTCTGAGTTCCAGTATA 58.046 41.667 6.53 0.00 43.38 1.47
1578 1580 2.830923 AGATTCCATGGATAGAGAGCCG 59.169 50.000 17.06 0.00 31.83 5.52
1819 1821 3.652869 TGAAAACACCTCTCTGGATCCTT 59.347 43.478 14.23 0.00 39.71 3.36
1847 1849 4.653341 TGAAAGAGAGATTGAGAGGGATCC 59.347 45.833 1.92 1.92 0.00 3.36
1999 2001 5.989168 TGATACCTAGTTGGCATTGATAACG 59.011 40.000 0.00 0.00 40.22 3.18
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
257 258 3.452755 TCATAACATGAGCGATTCGGT 57.547 42.857 11.02 11.02 41.33 4.69
440 441 3.565307 TGGTCAGAGGCAAATTGAAAGT 58.435 40.909 0.00 0.00 0.00 2.66
493 494 0.817654 AGCGCCCCTTATTTCAAAGC 59.182 50.000 2.29 0.00 0.00 3.51
502 503 3.319441 GAACCGGAAGCGCCCCTTA 62.319 63.158 9.46 0.00 32.78 2.69
724 725 6.205853 AGTGCGGTTTGAACTATTGATTTACA 59.794 34.615 0.00 0.00 33.30 2.41
1033 1034 1.846712 TTGATCCATGGACGGCACCA 61.847 55.000 18.99 5.68 44.41 4.17
1270 1272 4.466827 TGTGAATAGCCATCGACTACCTA 58.533 43.478 0.00 0.00 0.00 3.08
1578 1580 7.013369 GGAACATTCCATAAGTCTATTGGAACC 59.987 40.741 15.27 10.18 46.76 3.62
1663 1665 4.382901 GCATCCATGGCTGAATGGTTAAAA 60.383 41.667 19.76 0.00 46.24 1.52
1819 1821 6.214208 TCCCTCTCAATCTCTCTTTCAATTCA 59.786 38.462 0.00 0.00 0.00 2.57


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.