Multiple sequence alignment - TraesCS3A01G431000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G431000 chr3A 100.000 2141 0 0 1 2141 672909767 672907627 0.000000e+00 3954.0
1 TraesCS3A01G431000 chr3A 98.320 2143 33 3 1 2141 594899384 594897243 0.000000e+00 3755.0
2 TraesCS3A01G431000 chr3A 95.652 69 3 0 210 278 626021621 626021553 6.250000e-21 111.0
3 TraesCS3A01G431000 chr3A 100.000 58 0 0 1 58 671091533 671091590 8.080000e-20 108.0
4 TraesCS3A01G431000 chr3A 100.000 46 0 0 81 126 125194086 125194131 3.790000e-13 86.1
5 TraesCS3A01G431000 chr5D 98.880 2143 22 2 1 2141 503218458 503220600 0.000000e+00 3823.0
6 TraesCS3A01G431000 chr5D 98.507 2143 30 2 1 2141 503277986 503275844 0.000000e+00 3779.0
7 TraesCS3A01G431000 chr1A 98.880 2143 22 2 1 2141 554512488 554514630 0.000000e+00 3823.0
8 TraesCS3A01G431000 chr3B 98.693 2143 26 2 1 2141 201527264 201529406 0.000000e+00 3801.0
9 TraesCS3A01G431000 chr3B 96.414 2008 67 5 136 2141 700786918 700784914 0.000000e+00 3304.0
10 TraesCS3A01G431000 chr3B 99.103 1673 14 1 470 2141 101911885 101913557 0.000000e+00 3005.0
11 TraesCS3A01G431000 chr3B 98.077 156 3 0 1 156 810706443 810706288 2.710000e-69 272.0
12 TraesCS3A01G431000 chr3B 100.000 114 0 0 300 413 89098781 89098894 5.990000e-51 211.0
13 TraesCS3A01G431000 chr3D 98.647 2143 24 4 1 2141 589279302 589277163 0.000000e+00 3792.0
14 TraesCS3A01G431000 chr2A 97.901 2144 41 4 1 2141 335838868 335841010 0.000000e+00 3707.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G431000 chr3A 672907627 672909767 2140 True 3954 3954 100.000 1 2141 1 chr3A.!!$R3 2140
1 TraesCS3A01G431000 chr3A 594897243 594899384 2141 True 3755 3755 98.320 1 2141 1 chr3A.!!$R1 2140
2 TraesCS3A01G431000 chr5D 503218458 503220600 2142 False 3823 3823 98.880 1 2141 1 chr5D.!!$F1 2140
3 TraesCS3A01G431000 chr5D 503275844 503277986 2142 True 3779 3779 98.507 1 2141 1 chr5D.!!$R1 2140
4 TraesCS3A01G431000 chr1A 554512488 554514630 2142 False 3823 3823 98.880 1 2141 1 chr1A.!!$F1 2140
5 TraesCS3A01G431000 chr3B 201527264 201529406 2142 False 3801 3801 98.693 1 2141 1 chr3B.!!$F3 2140
6 TraesCS3A01G431000 chr3B 700784914 700786918 2004 True 3304 3304 96.414 136 2141 1 chr3B.!!$R1 2005
7 TraesCS3A01G431000 chr3B 101911885 101913557 1672 False 3005 3005 99.103 470 2141 1 chr3B.!!$F2 1671
8 TraesCS3A01G431000 chr3D 589277163 589279302 2139 True 3792 3792 98.647 1 2141 1 chr3D.!!$R1 2140
9 TraesCS3A01G431000 chr2A 335838868 335841010 2142 False 3707 3707 97.901 1 2141 1 chr2A.!!$F1 2140

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
827 831 2.830923 AGATTCCATGGATAGAGAGCCG 59.169 50.0 17.06 0.0 31.83 5.52 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1755 1761 2.040988 TCCCATGATCCCGAGCCA 60.041 61.111 0.0 0.0 0.0 4.75 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
519 521 9.508721 AATAGGTCCTATTCTTCTACCTTTTCT 57.491 33.333 17.17 0.00 40.89 2.52
725 729 5.953571 TCCTATGCTCTGAGTTCCAGTATA 58.046 41.667 6.53 0.00 43.38 1.47
827 831 2.830923 AGATTCCATGGATAGAGAGCCG 59.169 50.000 17.06 0.00 31.83 5.52
1068 1072 3.652869 TGAAAACACCTCTCTGGATCCTT 59.347 43.478 14.23 0.00 39.71 3.36
1096 1100 4.653341 TGAAAGAGAGATTGAGAGGGATCC 59.347 45.833 1.92 1.92 0.00 3.36
1248 1252 5.989168 TGATACCTAGTTGGCATTGATAACG 59.011 40.000 0.00 0.00 40.22 3.18
1755 1761 2.488153 GTTTGCGAGCCAAGGTAAGATT 59.512 45.455 0.00 0.00 34.34 2.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
519 521 4.466827 TGTGAATAGCCATCGACTACCTA 58.533 43.478 0.00 0.00 0.00 3.08
827 831 7.013369 GGAACATTCCATAAGTCTATTGGAACC 59.987 40.741 15.27 10.18 46.76 3.62
912 916 4.382901 GCATCCATGGCTGAATGGTTAAAA 60.383 41.667 19.76 0.00 46.24 1.52
1068 1072 6.214208 TCCCTCTCAATCTCTCTTTCAATTCA 59.786 38.462 0.00 0.00 0.00 2.57
1713 1719 5.520748 ACCCCAAGTTTGTCTATGAAGAT 57.479 39.130 0.00 0.00 33.30 2.40
1755 1761 2.040988 TCCCATGATCCCGAGCCA 60.041 61.111 0.00 0.00 0.00 4.75


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.