Multiple sequence alignment - TraesCS3A01G430900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G430900 chr3A 100.000 2211 0 0 1 2211 672905130 672907340 0 4084
1 TraesCS3A01G430900 chr3A 98.056 2212 41 2 1 2211 594894745 594896955 0 3845
2 TraesCS3A01G430900 chr3B 98.693 2219 20 5 1 2211 101916062 101913845 0 3928
3 TraesCS3A01G430900 chr3B 98.061 2218 35 5 1 2211 201531910 201529694 0 3851
4 TraesCS3A01G430900 chrUn 98.599 2213 27 3 1 2211 216513723 216515933 0 3912
5 TraesCS3A01G430900 chrUn 98.599 2213 27 3 1 2211 286269660 286267450 0 3912
6 TraesCS3A01G430900 chr3D 98.554 2213 29 3 1 2211 589272074 589274285 0 3906
7 TraesCS3A01G430900 chr5D 98.510 2215 29 3 1 2211 503223102 503220888 0 3904
8 TraesCS3A01G430900 chr5D 98.058 2214 39 4 1 2211 6193822 6191610 0 3847
9 TraesCS3A01G430900 chr1D 98.190 2210 38 2 1 2208 254393230 254395439 0 3858


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G430900 chr3A 672905130 672907340 2210 False 4084 4084 100.000 1 2211 1 chr3A.!!$F2 2210
1 TraesCS3A01G430900 chr3A 594894745 594896955 2210 False 3845 3845 98.056 1 2211 1 chr3A.!!$F1 2210
2 TraesCS3A01G430900 chr3B 101913845 101916062 2217 True 3928 3928 98.693 1 2211 1 chr3B.!!$R1 2210
3 TraesCS3A01G430900 chr3B 201529694 201531910 2216 True 3851 3851 98.061 1 2211 1 chr3B.!!$R2 2210
4 TraesCS3A01G430900 chrUn 216513723 216515933 2210 False 3912 3912 98.599 1 2211 1 chrUn.!!$F1 2210
5 TraesCS3A01G430900 chrUn 286267450 286269660 2210 True 3912 3912 98.599 1 2211 1 chrUn.!!$R1 2210
6 TraesCS3A01G430900 chr3D 589272074 589274285 2211 False 3906 3906 98.554 1 2211 1 chr3D.!!$F1 2210
7 TraesCS3A01G430900 chr5D 503220888 503223102 2214 True 3904 3904 98.510 1 2211 1 chr5D.!!$R2 2210
8 TraesCS3A01G430900 chr5D 6191610 6193822 2212 True 3847 3847 98.058 1 2211 1 chr5D.!!$R1 2210
9 TraesCS3A01G430900 chr1D 254393230 254395439 2209 False 3858 3858 98.190 1 2208 1 chr1D.!!$F1 2207

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
850 852 1.227999 AACCAGACCGTGCACATTCG 61.228 55.0 18.64 2.05 0.0 3.34 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1748 1753 0.251698 TCATGATTTGGGCTGGCACA 60.252 50.0 2.88 0.0 0.0 4.57 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
106 107 7.083858 GCTATTACTCAAACAAGCATGAAACA 58.916 34.615 0.00 0.00 32.25 2.83
546 548 5.767816 AATAACCCCTTATGTGCGAAATC 57.232 39.130 0.00 0.00 0.00 2.17
550 552 4.787551 ACCCCTTATGTGCGAAATCATAA 58.212 39.130 0.00 0.00 35.89 1.90
800 802 7.872993 TGAACTTATAATCATGGAATCGACTCC 59.127 37.037 5.82 5.82 35.88 3.85
850 852 1.227999 AACCAGACCGTGCACATTCG 61.228 55.000 18.64 2.05 0.00 3.34
1020 1022 0.185901 TGCACCTCTTTGGGCTTCTT 59.814 50.000 0.00 0.00 41.11 2.52
1157 1159 2.688446 GGCCTATATGACCGATCGATCA 59.312 50.000 24.40 15.98 0.00 2.92
1273 1275 3.007506 TGATGGTGAAATGGTAGACACGT 59.992 43.478 0.00 0.00 34.59 4.49
1446 1448 3.511934 TCTCCCTGAGAAAAGTAGACAGC 59.488 47.826 0.00 0.00 35.59 4.40
1525 1528 7.769044 CGAAGGAGATAATAAAGAACCCAAAGA 59.231 37.037 0.00 0.00 0.00 2.52
1550 1553 2.116238 GGTATCCTACTGCAAGGGTGA 58.884 52.381 4.59 0.00 39.30 4.02
1646 1651 4.879104 TTTTTACGCGACAGGAAAAAGA 57.121 36.364 15.93 0.00 0.00 2.52
1653 1658 3.650139 GCGACAGGAAAAAGAGACTACA 58.350 45.455 0.00 0.00 0.00 2.74
1797 1807 3.771577 ACTTGGATTTGGTTCTCTCGT 57.228 42.857 0.00 0.00 0.00 4.18
1863 1873 5.378332 TCCCGAATAAGAAAACAGAAACCA 58.622 37.500 0.00 0.00 0.00 3.67
2126 2139 3.662247 ATCGGATCGGGTGAATTAGAC 57.338 47.619 0.00 0.00 0.00 2.59
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
550 552 8.670521 ATTGTTTGATCTTAAAGGGGATCTTT 57.329 30.769 0.00 0.00 46.49 2.52
850 852 6.097915 TCGAATGACCCCTTCTCATAATAC 57.902 41.667 0.00 0.00 0.00 1.89
1020 1022 8.105097 TGTACAATCCAATTTCTCGATTCAAA 57.895 30.769 0.00 0.00 0.00 2.69
1157 1159 5.584551 AAGGTGGAGTCTTGGAGTATTTT 57.415 39.130 0.00 0.00 0.00 1.82
1273 1275 3.005791 TCAGCACGAGATTTTGAGTCTCA 59.994 43.478 0.00 0.00 41.70 3.27
1525 1528 3.392616 CCCTTGCAGTAGGATACCATCTT 59.607 47.826 5.98 0.00 44.47 2.40
1550 1553 6.950619 AGCAACCTCTTTTGGATTCTTAAGAT 59.049 34.615 5.89 0.00 0.00 2.40
1646 1651 7.272244 CAAACAAAAAGGGGAATTTGTAGTCT 58.728 34.615 4.52 0.00 46.09 3.24
1653 1658 4.143986 TCGCAAACAAAAAGGGGAATTT 57.856 36.364 0.00 0.00 0.00 1.82
1748 1753 0.251698 TCATGATTTGGGCTGGCACA 60.252 50.000 2.88 0.00 0.00 4.57
1797 1807 1.460743 CTCTGCAACTCGCGATTTTCA 59.539 47.619 10.36 10.56 46.97 2.69
1863 1873 3.459969 ACTCTTGTGGTTTCCTCTTCCTT 59.540 43.478 0.00 0.00 0.00 3.36
2126 2139 2.893637 CCAACGGACCTCTGTCTATTG 58.106 52.381 0.00 0.00 41.47 1.90


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.