Multiple sequence alignment - TraesCS3A01G430700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G430700 chr3A 100.000 2177 0 0 1 2177 672899767 672901943 0 4021
1 TraesCS3A01G430700 chr3A 98.622 2177 29 1 1 2177 66007378 66009553 0 3853
2 TraesCS3A01G430700 chr6D 98.714 2177 28 0 1 2177 389254923 389252747 0 3866
3 TraesCS3A01G430700 chr5D 98.576 2177 30 1 1 2177 503238780 503236605 0 3847
4 TraesCS3A01G430700 chr5D 98.662 2167 28 1 11 2177 503243019 503240854 0 3840
5 TraesCS3A01G430700 chrUn 98.255 2178 34 2 1 2177 216508364 216510538 0 3808
6 TraesCS3A01G430700 chr3B 98.025 2177 42 1 1 2177 201537274 201535099 0 3781
7 TraesCS3A01G430700 chr2A 97.887 2177 46 0 1 2177 335845066 335842890 0 3766
8 TraesCS3A01G430700 chr2B 97.565 2177 53 0 1 2177 474918684 474916508 0 3727
9 TraesCS3A01G430700 chr1B 97.611 2177 46 1 1 2177 633743659 633745829 0 3727


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G430700 chr3A 672899767 672901943 2176 False 4021.0 4021 100.000 1 2177 1 chr3A.!!$F2 2176
1 TraesCS3A01G430700 chr3A 66007378 66009553 2175 False 3853.0 3853 98.622 1 2177 1 chr3A.!!$F1 2176
2 TraesCS3A01G430700 chr6D 389252747 389254923 2176 True 3866.0 3866 98.714 1 2177 1 chr6D.!!$R1 2176
3 TraesCS3A01G430700 chr5D 503236605 503243019 6414 True 3843.5 3847 98.619 1 2177 2 chr5D.!!$R1 2176
4 TraesCS3A01G430700 chrUn 216508364 216510538 2174 False 3808.0 3808 98.255 1 2177 1 chrUn.!!$F1 2176
5 TraesCS3A01G430700 chr3B 201535099 201537274 2175 True 3781.0 3781 98.025 1 2177 1 chr3B.!!$R1 2176
6 TraesCS3A01G430700 chr2A 335842890 335845066 2176 True 3766.0 3766 97.887 1 2177 1 chr2A.!!$R1 2176
7 TraesCS3A01G430700 chr2B 474916508 474918684 2176 True 3727.0 3727 97.565 1 2177 1 chr2B.!!$R1 2176
8 TraesCS3A01G430700 chr1B 633743659 633745829 2170 False 3727.0 3727 97.611 1 2177 1 chr1B.!!$F1 2176

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
42 43 0.605319 CAAGGGCAGGTTCTTACGCA 60.605 55.0 0.0 0.0 0.0 5.24 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1500 5750 3.576648 GTGAGTCGTCCGAGATCTTTTT 58.423 45.455 0.0 0.0 0.0 1.94 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
21 22 2.764010 GTTTCCAGTTGTTGTTCCCCTT 59.236 45.455 0.00 0.00 0.00 3.95
42 43 0.605319 CAAGGGCAGGTTCTTACGCA 60.605 55.000 0.00 0.00 0.00 5.24
337 338 0.744414 CATTCCCATTCGCTCGTGGT 60.744 55.000 0.00 0.00 33.55 4.16
396 397 4.561105 GTTTAGGGATAATCAGGCTCGAG 58.439 47.826 8.45 8.45 0.00 4.04
511 512 1.128188 AGGGGCGAGAAACTCAAGGT 61.128 55.000 0.00 0.00 0.00 3.50
697 4946 4.015084 AGCAGGTTTCCATGAAGAAGATG 58.985 43.478 0.00 0.00 0.00 2.90
718 4967 6.883217 AGATGTTGTTCAGCATGTTCTATTCT 59.117 34.615 6.85 0.00 37.40 2.40
1180 5430 1.995376 ATTTGAAGCGGGTTGACCTT 58.005 45.000 0.00 0.00 36.97 3.50
1267 5517 1.204146 AATGTAGGACTGGTGCCGAT 58.796 50.000 0.00 0.00 0.00 4.18
1297 5547 4.039245 TCACGGAAGAAAGAACTCACAGAT 59.961 41.667 0.00 0.00 0.00 2.90
1500 5750 5.003160 CCTTCAACACAACATAGGTCATCA 58.997 41.667 0.00 0.00 0.00 3.07
1574 5824 6.374417 TTCCTATTTGAAGAGTGCCTAACT 57.626 37.500 0.00 0.00 43.85 2.24
2097 6348 2.823747 TCGAAAGAATTGACCGAGGAGA 59.176 45.455 0.00 0.00 37.03 3.71
2098 6349 3.447586 TCGAAAGAATTGACCGAGGAGAT 59.552 43.478 0.00 0.00 37.03 2.75
2104 6355 4.651503 AGAATTGACCGAGGAGATGTATGT 59.348 41.667 0.00 0.00 0.00 2.29
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
21 22 0.323629 CGTAAGAACCTGCCCTTGGA 59.676 55.000 0.00 0.00 43.02 3.53
42 43 0.390735 GTGGCGAACGGGTGAGTAAT 60.391 55.000 0.00 0.00 0.00 1.89
337 338 6.457159 TTTCTATTTTGACTTACTCCCCCA 57.543 37.500 0.00 0.00 0.00 4.96
396 397 2.012673 GACATGGTGGAAGTCATCAGC 58.987 52.381 0.00 0.00 40.25 4.26
697 4946 9.319143 AGTATAGAATAGAACATGCTGAACAAC 57.681 33.333 0.00 0.00 0.00 3.32
718 4967 4.166725 TCGGGTTCTTCTCCTACCAGTATA 59.833 45.833 0.00 0.00 33.51 1.47
770 5020 6.386927 ACCCATATCATCTTGACTTGGTTCTA 59.613 38.462 6.74 0.00 32.67 2.10
1180 5430 4.350368 TTGTACCATGAGAGAAGCACAA 57.650 40.909 0.00 0.00 0.00 3.33
1267 5517 6.097915 AGTTCTTTCTTCCGTGATGAACTA 57.902 37.500 0.00 1.55 37.82 2.24
1500 5750 3.576648 GTGAGTCGTCCGAGATCTTTTT 58.423 45.455 0.00 0.00 0.00 1.94
1574 5824 4.580167 GGTTAATGTGAGCTTATCCATGCA 59.420 41.667 0.00 0.00 0.00 3.96
2097 6348 7.011389 CGTACATGAGATTTTCACCACATACAT 59.989 37.037 0.00 0.00 38.99 2.29
2098 6349 6.312672 CGTACATGAGATTTTCACCACATACA 59.687 38.462 0.00 0.00 38.99 2.29
2104 6355 4.280436 ACCGTACATGAGATTTTCACCA 57.720 40.909 0.00 0.00 38.99 4.17


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.