Multiple sequence alignment - TraesCS3A01G430400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G430400 chr3A 100.000 2564 0 0 1 2564 672881448 672878885 0 4735
1 TraesCS3A01G430400 chr2D 98.053 2568 44 3 1 2564 630266209 630268774 0 4460
2 TraesCS3A01G430400 chr2D 97.897 2568 46 4 1 2564 272804676 272802113 0 4436
3 TraesCS3A01G430400 chr2D 97.270 2564 65 4 1 2564 196966757 196964199 0 4342
4 TraesCS3A01G430400 chr3B 97.554 2576 47 6 1 2564 201563799 201561228 0 4394
5 TraesCS3A01G430400 chr7B 97.360 2576 51 7 1 2564 662734496 662737066 0 4364
6 TraesCS3A01G430400 chr1B 96.856 2576 65 6 1 2564 633731889 633729318 0 4294
7 TraesCS3A01G430400 chr5B 96.221 2567 85 9 1 2564 432873713 432876270 0 4193
8 TraesCS3A01G430400 chr4A 95.757 2569 87 11 1 2562 219342877 219340324 0 4120


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G430400 chr3A 672878885 672881448 2563 True 4735 4735 100.000 1 2564 1 chr3A.!!$R1 2563
1 TraesCS3A01G430400 chr2D 630266209 630268774 2565 False 4460 4460 98.053 1 2564 1 chr2D.!!$F1 2563
2 TraesCS3A01G430400 chr2D 272802113 272804676 2563 True 4436 4436 97.897 1 2564 1 chr2D.!!$R2 2563
3 TraesCS3A01G430400 chr2D 196964199 196966757 2558 True 4342 4342 97.270 1 2564 1 chr2D.!!$R1 2563
4 TraesCS3A01G430400 chr3B 201561228 201563799 2571 True 4394 4394 97.554 1 2564 1 chr3B.!!$R1 2563
5 TraesCS3A01G430400 chr7B 662734496 662737066 2570 False 4364 4364 97.360 1 2564 1 chr7B.!!$F1 2563
6 TraesCS3A01G430400 chr1B 633729318 633731889 2571 True 4294 4294 96.856 1 2564 1 chr1B.!!$R1 2563
7 TraesCS3A01G430400 chr5B 432873713 432876270 2557 False 4193 4193 96.221 1 2564 1 chr5B.!!$F1 2563
8 TraesCS3A01G430400 chr4A 219340324 219342877 2553 True 4120 4120 95.757 1 2562 1 chr4A.!!$R1 2561

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
481 488 0.991355 ATTGGGGCTTATCGGGACCA 60.991 55.0 0.0 0.0 32.41 4.02 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2453 2482 0.03716 GTTTTGTTCCTAGCCCCGGA 59.963 55.0 0.73 0.0 0.0 5.14 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
458 465 5.297029 GGTTTTATTAGCGGAGAAGAAGCAT 59.703 40.000 0.00 0.0 0.00 3.79
481 488 0.991355 ATTGGGGCTTATCGGGACCA 60.991 55.000 0.00 0.0 32.41 4.02
699 708 5.607119 TGAAAATTTAGAAGTCTGACGCC 57.393 39.130 1.52 0.0 0.00 5.68
713 722 5.998363 AGTCTGACGCCTTAAGAAAGAAAAT 59.002 36.000 3.36 0.0 34.37 1.82
776 785 3.385193 AAACCTTCGCCCAATTTTGAG 57.615 42.857 0.00 0.0 0.00 3.02
887 896 4.705746 TGGAAAATCCGTCCACCG 57.294 55.556 0.00 0.0 40.33 4.94
1038 1047 7.844779 AGGGTAGAGGTAGAAACTATCAATTCA 59.155 37.037 0.00 0.0 0.00 2.57
1226 1235 1.141858 GGGCCTGCTTCAAGCTATAGT 59.858 52.381 11.57 0.0 42.97 2.12
1321 1330 5.717178 GGACCCTCTATAGCAGTCATATCAA 59.283 44.000 14.60 0.0 0.00 2.57
1549 1558 8.737168 TTTTTGTGTGCTAGCAATATCTCTAT 57.263 30.769 21.29 0.0 0.00 1.98
1559 1568 7.277539 GCTAGCAATATCTCTATGTGTGATTCC 59.722 40.741 10.63 0.0 32.05 3.01
1775 1785 8.753497 ACTCTTTATCCCAAGGTTGATATTTC 57.247 34.615 0.00 0.0 0.00 2.17
1804 1814 3.070734 AGTCATCATATCTTGAAGCGGCT 59.929 43.478 0.00 0.0 38.03 5.52
2113 2130 9.647797 GAACGAATTAACCCTTTATCCATTTTT 57.352 29.630 0.00 0.0 0.00 1.94
2137 2154 6.991497 TTCTTTTTAAATACCCCCTCCCTA 57.009 37.500 0.00 0.0 0.00 3.53
2474 2504 1.611519 CGGGGCTAGGAACAAAACAA 58.388 50.000 0.00 0.0 0.00 2.83
2504 2534 7.192852 TCCTTTTTCTGATCATAGAGAAGCT 57.807 36.000 0.00 0.0 30.03 3.74
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
418 425 4.950205 AAAACCTACTCCTTCAACTCGA 57.050 40.909 0.00 0.00 0.00 4.04
458 465 3.558033 GTCCCGATAAGCCCCAATTTAA 58.442 45.455 0.00 0.00 0.00 1.52
481 488 5.730550 TGTATTCCAGAAGCTCGTAACATT 58.269 37.500 0.00 0.00 0.00 2.71
666 675 9.674068 GACTTCTAAATTTTCATAAGGTCCTCT 57.326 33.333 0.00 0.00 0.00 3.69
680 689 7.159372 TCTTAAGGCGTCAGACTTCTAAATTT 58.841 34.615 1.85 0.00 43.67 1.82
776 785 6.305693 ACATAAAGCTCTTGTCTTGACAAC 57.694 37.500 11.62 3.80 0.00 3.32
887 896 8.673711 GGAAGAATTTGCAAATTAATAAACCCC 58.326 33.333 31.79 20.36 38.64 4.95
1226 1235 9.886132 CTTTAAAAAGTAGCTTAGTCCCATCTA 57.114 33.333 0.00 0.00 0.00 1.98
2113 2130 6.235765 AGGGAGGGGGTATTTAAAAAGAAA 57.764 37.500 0.00 0.00 0.00 2.52
2453 2482 0.037160 GTTTTGTTCCTAGCCCCGGA 59.963 55.000 0.73 0.00 0.00 5.14
2455 2485 1.611519 TTGTTTTGTTCCTAGCCCCG 58.388 50.000 0.00 0.00 0.00 5.73
2474 2504 8.776119 TCTCTATGATCAGAAAAAGGAAAGGAT 58.224 33.333 0.09 0.00 0.00 3.24
2504 2534 6.533723 CGTACATGAAACCTTAGCTTCATACA 59.466 38.462 0.00 0.00 39.66 2.29


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.