Multiple sequence alignment - TraesCS3A01G430300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G430300 chr3A 100.000 2213 0 0 1 2213 672879547 672877335 0.000000e+00 4087
1 TraesCS3A01G430300 chr3A 94.565 92 4 1 152 242 102257661 102257570 8.240000e-30 141
2 TraesCS3A01G430300 chr3B 97.391 2223 46 6 1 2213 201561895 201559675 0.000000e+00 3773
3 TraesCS3A01G430300 chr2D 97.344 2221 34 10 1 2213 272802777 272800574 0.000000e+00 3751
4 TraesCS3A01G430300 chr2D 97.739 1813 35 3 1 1808 630268109 630269920 0.000000e+00 3116
5 TraesCS3A01G430300 chr1B 96.985 2222 54 7 1 2213 633729984 633727767 0.000000e+00 3720
6 TraesCS3A01G430300 chr5B 96.479 2215 69 6 1 2213 432875612 432877819 0.000000e+00 3650
7 TraesCS3A01G430300 chr5B 96.491 513 16 2 1703 2213 413608022 413608534 0.000000e+00 846
8 TraesCS3A01G430300 chr5D 96.213 2218 73 8 1 2213 432293831 432291620 0.000000e+00 3620
9 TraesCS3A01G430300 chr4A 95.672 2218 85 9 1 2213 310761294 310763505 0.000000e+00 3554
10 TraesCS3A01G430300 chr4A 94.946 2216 82 12 1 2213 219340976 219338788 0.000000e+00 3445
11 TraesCS3A01G430300 chr7A 93.913 2218 107 14 1 2213 352678560 352676366 0.000000e+00 3323


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G430300 chr3A 672877335 672879547 2212 True 4087 4087 100.000 1 2213 1 chr3A.!!$R2 2212
1 TraesCS3A01G430300 chr3B 201559675 201561895 2220 True 3773 3773 97.391 1 2213 1 chr3B.!!$R1 2212
2 TraesCS3A01G430300 chr2D 272800574 272802777 2203 True 3751 3751 97.344 1 2213 1 chr2D.!!$R1 2212
3 TraesCS3A01G430300 chr2D 630268109 630269920 1811 False 3116 3116 97.739 1 1808 1 chr2D.!!$F1 1807
4 TraesCS3A01G430300 chr1B 633727767 633729984 2217 True 3720 3720 96.985 1 2213 1 chr1B.!!$R1 2212
5 TraesCS3A01G430300 chr5B 432875612 432877819 2207 False 3650 3650 96.479 1 2213 1 chr5B.!!$F2 2212
6 TraesCS3A01G430300 chr5B 413608022 413608534 512 False 846 846 96.491 1703 2213 1 chr5B.!!$F1 510
7 TraesCS3A01G430300 chr5D 432291620 432293831 2211 True 3620 3620 96.213 1 2213 1 chr5D.!!$R1 2212
8 TraesCS3A01G430300 chr4A 310761294 310763505 2211 False 3554 3554 95.672 1 2213 1 chr4A.!!$F1 2212
9 TraesCS3A01G430300 chr4A 219338788 219340976 2188 True 3445 3445 94.946 1 2213 1 chr4A.!!$R1 2212
10 TraesCS3A01G430300 chr7A 352676366 352678560 2194 True 3323 3323 93.913 1 2213 1 chr7A.!!$R1 2212

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
573 593 1.611519 CGGGGCTAGGAACAAAACAA 58.388 50.0 0.0 0.0 0.0 2.83 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1526 1549 6.01484 ACAACGGGTAAATCTATCGGACATAT 60.015 38.462 0.0 0.0 0.0 1.78 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
236 238 6.991497 TTCTTTTTAAATACCCCCTCCCTA 57.009 37.500 0.00 0.0 0.00 3.53
573 593 1.611519 CGGGGCTAGGAACAAAACAA 58.388 50.000 0.00 0.0 0.00 2.83
603 623 7.192852 TCCTTTTTCTGATCATAGAGAAGCT 57.807 36.000 0.00 0.0 30.03 3.74
664 684 4.750098 CGGTGGGAACTATGATGTTATCAC 59.250 45.833 0.00 0.0 43.01 3.06
751 772 6.710499 TTTTTGGATGGAATATTTGGGGTT 57.290 33.333 0.00 0.0 0.00 4.11
1032 1055 4.452114 GCAGTTGGAATTTTGGAAATGACC 59.548 41.667 0.00 0.0 0.00 4.02
1526 1549 2.223144 GCTTGTGAAGTATGTGTTCGCA 59.777 45.455 0.00 0.0 41.50 5.10
1650 1673 4.709250 TGTGGCAATTGTGTTGAGTACTA 58.291 39.130 7.40 0.0 0.00 1.82
1720 1743 9.730705 ACCTATGATCGTCATGAATTGAATTAT 57.269 29.630 0.00 0.0 37.70 1.28
1755 1778 2.674796 AGTCGGTTAGCAATCTCCAC 57.325 50.000 0.00 0.0 0.00 4.02
1796 1819 9.065871 CAATTCAAACAATTAGGAATTCGTCTC 57.934 33.333 3.47 0.0 37.75 3.36
1849 1873 9.020813 TCGAATTCAAGAACGATTACTGATTAG 57.979 33.333 6.22 0.0 0.00 1.73
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
552 572 0.037160 GTTTTGTTCCTAGCCCCGGA 59.963 55.000 0.73 0.00 0.00 5.14
554 574 1.611519 TTGTTTTGTTCCTAGCCCCG 58.388 50.000 0.00 0.00 0.00 5.73
573 593 8.776119 TCTCTATGATCAGAAAAAGGAAAGGAT 58.224 33.333 0.09 0.00 0.00 3.24
603 623 6.533723 CGTACATGAAACCTTAGCTTCATACA 59.466 38.462 0.00 0.00 39.66 2.29
664 684 9.186323 CTTGAACTGTTAGATAATCATAGTCGG 57.814 37.037 0.00 0.00 0.00 4.79
748 769 5.369409 ACCAGAAAACCTATAGGCTAACC 57.631 43.478 19.25 4.84 39.32 2.85
1526 1549 6.014840 ACAACGGGTAAATCTATCGGACATAT 60.015 38.462 0.00 0.00 0.00 1.78
1650 1673 6.435277 AGTCATTGATAAACAGCTTGTTGGAT 59.565 34.615 2.88 1.12 40.14 3.41
1720 1743 7.966204 GCTAACCGACTTAAAGCAATTTGATTA 59.034 33.333 0.00 0.00 33.38 1.75
1755 1778 7.377398 TGTTTGAATTGTGTAATCTCCCATTG 58.623 34.615 0.00 0.00 0.00 2.82


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.