Multiple sequence alignment - TraesCS3A01G430000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G430000 chr3A 100.000 2306 0 0 1 2306 672877691 672875386 0.000000e+00 4259
1 TraesCS3A01G430000 chr3A 95.620 548 14 5 1759 2306 672930008 672929471 0.000000e+00 870
2 TraesCS3A01G430000 chr3A 89.855 414 15 7 1759 2171 5966167 5966554 7.350000e-140 507
3 TraesCS3A01G430000 chr5B 97.604 1753 31 7 1 1746 413608176 413609924 0.000000e+00 2994
4 TraesCS3A01G430000 chr5B 95.909 1760 48 10 1 1756 432877465 432879204 0.000000e+00 2830
5 TraesCS3A01G430000 chr2D 96.966 1780 19 7 1 1756 630271034 630272802 0.000000e+00 2955
6 TraesCS3A01G430000 chr2D 96.859 1783 18 8 1 1756 33934557 33936328 0.000000e+00 2948
7 TraesCS3A01G430000 chr4D 96.589 1759 50 7 1 1756 245649424 245651175 0.000000e+00 2907
8 TraesCS3A01G430000 chr3B 96.538 1762 34 9 1 1756 201560033 201558293 0.000000e+00 2891
9 TraesCS3A01G430000 chrUn 97.090 1684 18 7 100 1756 371049286 371050965 0.000000e+00 2809
10 TraesCS3A01G430000 chrUn 96.741 491 8 4 1270 1756 451362689 451363175 0.000000e+00 811
11 TraesCS3A01G430000 chr4A 94.830 1760 63 17 1 1756 310763147 310764882 0.000000e+00 2721
12 TraesCS3A01G430000 chr4A 92.899 676 24 11 1080 1754 219308174 219307522 0.000000e+00 961
13 TraesCS3A01G430000 chr4A 92.027 301 11 8 1759 2057 692482260 692482549 5.930000e-111 411
14 TraesCS3A01G430000 chr4A 94.372 231 11 2 1941 2171 538504347 538504119 1.010000e-93 353
15 TraesCS3A01G430000 chr1A 96.086 1482 44 8 268 1746 371922144 371923614 0.000000e+00 2403
16 TraesCS3A01G430000 chr1A 88.793 348 26 13 1759 2102 20511801 20511463 4.580000e-112 414
17 TraesCS3A01G430000 chr1A 93.991 233 10 4 1941 2171 588364865 588364635 1.310000e-92 350
18 TraesCS3A01G430000 chr5D 96.963 1383 36 6 1 1379 432291979 432290599 0.000000e+00 2316
19 TraesCS3A01G430000 chr1B 97.626 1306 28 3 1 1304 633728123 633726819 0.000000e+00 2237
20 TraesCS3A01G430000 chr1B 91.864 295 12 10 1759 2052 654143195 654143478 3.570000e-108 401
21 TraesCS3A01G430000 chr1B 91.837 294 10 8 1759 2050 618720015 618719734 4.620000e-107 398
22 TraesCS3A01G430000 chr3D 92.971 882 27 10 867 1746 182097139 182097987 0.000000e+00 1253
23 TraesCS3A01G430000 chr2A 93.841 552 20 10 1759 2306 20392929 20392388 0.000000e+00 819
24 TraesCS3A01G430000 chr5A 97.125 487 7 4 1272 1756 482027372 482026891 0.000000e+00 815
25 TraesCS3A01G430000 chr6A 89.880 415 29 9 1759 2169 10972309 10971904 2.630000e-144 521
26 TraesCS3A01G430000 chr7A 89.785 372 24 10 1759 2126 490089145 490089506 4.490000e-127 464


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G430000 chr3A 672875386 672877691 2305 True 4259 4259 100.000 1 2306 1 chr3A.!!$R1 2305
1 TraesCS3A01G430000 chr3A 672929471 672930008 537 True 870 870 95.620 1759 2306 1 chr3A.!!$R2 547
2 TraesCS3A01G430000 chr5B 413608176 413609924 1748 False 2994 2994 97.604 1 1746 1 chr5B.!!$F1 1745
3 TraesCS3A01G430000 chr5B 432877465 432879204 1739 False 2830 2830 95.909 1 1756 1 chr5B.!!$F2 1755
4 TraesCS3A01G430000 chr2D 630271034 630272802 1768 False 2955 2955 96.966 1 1756 1 chr2D.!!$F2 1755
5 TraesCS3A01G430000 chr2D 33934557 33936328 1771 False 2948 2948 96.859 1 1756 1 chr2D.!!$F1 1755
6 TraesCS3A01G430000 chr4D 245649424 245651175 1751 False 2907 2907 96.589 1 1756 1 chr4D.!!$F1 1755
7 TraesCS3A01G430000 chr3B 201558293 201560033 1740 True 2891 2891 96.538 1 1756 1 chr3B.!!$R1 1755
8 TraesCS3A01G430000 chrUn 371049286 371050965 1679 False 2809 2809 97.090 100 1756 1 chrUn.!!$F1 1656
9 TraesCS3A01G430000 chr4A 310763147 310764882 1735 False 2721 2721 94.830 1 1756 1 chr4A.!!$F1 1755
10 TraesCS3A01G430000 chr4A 219307522 219308174 652 True 961 961 92.899 1080 1754 1 chr4A.!!$R1 674
11 TraesCS3A01G430000 chr1A 371922144 371923614 1470 False 2403 2403 96.086 268 1746 1 chr1A.!!$F1 1478
12 TraesCS3A01G430000 chr5D 432290599 432291979 1380 True 2316 2316 96.963 1 1379 1 chr5D.!!$R1 1378
13 TraesCS3A01G430000 chr1B 633726819 633728123 1304 True 2237 2237 97.626 1 1304 1 chr1B.!!$R2 1303
14 TraesCS3A01G430000 chr3D 182097139 182097987 848 False 1253 1253 92.971 867 1746 1 chr3D.!!$F1 879
15 TraesCS3A01G430000 chr2A 20392388 20392929 541 True 819 819 93.841 1759 2306 1 chr2A.!!$R1 547

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
370 374 5.514659 CCAACCCCATTTATTCTGCCTTTTT 60.515 40.0 0.0 0.0 0.0 1.94 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1748 1837 1.887198 TGCCCTTCGCCGAAAAATTTA 59.113 42.857 0.0 0.0 36.24 1.4 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
370 374 5.514659 CCAACCCCATTTATTCTGCCTTTTT 60.515 40.000 0.00 0.0 0.00 1.94
1184 1191 7.931275 AGTCGCCAATTAAAAGGAGATATTTC 58.069 34.615 6.33 0.0 36.14 2.17
1209 1216 4.934602 GCAATTTTTGTTATAGCCCTTGCA 59.065 37.500 0.00 0.0 41.13 4.08
1280 1288 6.802348 CGTAATAGGAAATCCACTCGTATCAG 59.198 42.308 1.67 0.0 38.89 2.90
1692 1781 5.092554 TGGATAAACCATTGCTTCGTCTA 57.907 39.130 0.00 0.0 44.64 2.59
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
370 374 4.469657 ACAAACAAGAACTAATCCCAGCA 58.530 39.130 0.0 0.0 0.00 4.41
437 443 6.007076 TCCCACATAAATAAGAAGTTGTGCA 58.993 36.000 0.0 0.0 34.57 4.57
1184 1191 4.385358 AGGGCTATAACAAAAATTGCGG 57.615 40.909 0.0 0.0 0.00 5.69
1595 1684 9.220767 GAAGAGAGCCAAGAGACTTTAATTTTA 57.779 33.333 0.0 0.0 0.00 1.52
1746 1835 3.695060 TGCCCTTCGCCGAAAAATTTATA 59.305 39.130 0.0 0.0 36.24 0.98
1748 1837 1.887198 TGCCCTTCGCCGAAAAATTTA 59.113 42.857 0.0 0.0 36.24 1.40


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.