Multiple sequence alignment - TraesCS3A01G409300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G409300 chr3A 100.000 2285 0 0 1 2285 653870540 653872824 0 4220
1 TraesCS3A01G409300 chr3A 98.779 1474 18 0 812 2285 514529750 514531223 0 2623
2 TraesCS3A01G409300 chr3A 98.711 1474 19 0 812 2285 627956138 627954665 0 2617
3 TraesCS3A01G409300 chr3A 96.399 833 12 2 1 816 627957473 627956642 0 1356
4 TraesCS3A01G409300 chr3A 96.038 833 15 2 1 816 514528416 514529247 0 1339
5 TraesCS3A01G409300 chr7A 98.711 1474 19 0 812 2285 613754465 613752992 0 2617
6 TraesCS3A01G409300 chr7A 96.399 833 13 1 1 816 613755801 613754969 0 1356
7 TraesCS3A01G409300 chr7B 98.440 1474 21 1 812 2285 577194907 577193436 0 2593
8 TraesCS3A01G409300 chr6B 98.440 1474 22 1 812 2285 439442162 439440690 0 2593
9 TraesCS3A01G409300 chr6B 98.304 1474 25 0 812 2285 693564859 693563386 0 2584
10 TraesCS3A01G409300 chr6B 94.718 833 13 2 1 816 439443484 439442666 0 1266
11 TraesCS3A01G409300 chr6A 98.372 1474 24 0 812 2285 214162306 214160833 0 2590
12 TraesCS3A01G409300 chr6A 98.304 1474 25 0 812 2285 157653042 157654515 0 2584
13 TraesCS3A01G409300 chr6A 96.038 833 16 1 1 816 157651857 157652689 0 1339
14 TraesCS3A01G409300 chr6A 94.958 833 11 2 1 816 214163628 214162810 0 1277
15 TraesCS3A01G409300 chr5B 98.304 1474 25 0 812 2285 524582173 524580700 0 2584
16 TraesCS3A01G409300 chr5B 96.229 822 14 1 12 816 332627190 332626369 0 1330
17 TraesCS3A01G409300 chr5B 96.059 812 14 2 1 795 267766163 267766973 0 1306
18 TraesCS3A01G409300 chr2B 96.882 834 8 1 1 816 673834163 673834996 0 1380
19 TraesCS3A01G409300 chr2A 96.163 834 14 1 1 816 470632403 470633236 0 1347
20 TraesCS3A01G409300 chr1A 96.158 833 15 2 1 816 3647719 3646887 0 1345
21 TraesCS3A01G409300 chr5A 95.798 833 18 1 1 816 617986394 617987226 0 1328
22 TraesCS3A01G409300 chr1B 96.108 668 8 1 1 650 602251535 602252202 0 1074


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G409300 chr3A 653870540 653872824 2284 False 4220.0 4220 100.0000 1 2285 1 chr3A.!!$F1 2284
1 TraesCS3A01G409300 chr3A 627954665 627957473 2808 True 1986.5 2617 97.5550 1 2285 2 chr3A.!!$R1 2284
2 TraesCS3A01G409300 chr3A 514528416 514531223 2807 False 1981.0 2623 97.4085 1 2285 2 chr3A.!!$F2 2284
3 TraesCS3A01G409300 chr7A 613752992 613755801 2809 True 1986.5 2617 97.5550 1 2285 2 chr7A.!!$R1 2284
4 TraesCS3A01G409300 chr7B 577193436 577194907 1471 True 2593.0 2593 98.4400 812 2285 1 chr7B.!!$R1 1473
5 TraesCS3A01G409300 chr6B 693563386 693564859 1473 True 2584.0 2584 98.3040 812 2285 1 chr6B.!!$R1 1473
6 TraesCS3A01G409300 chr6B 439440690 439443484 2794 True 1929.5 2593 96.5790 1 2285 2 chr6B.!!$R2 2284
7 TraesCS3A01G409300 chr6A 157651857 157654515 2658 False 1961.5 2584 97.1710 1 2285 2 chr6A.!!$F1 2284
8 TraesCS3A01G409300 chr6A 214160833 214163628 2795 True 1933.5 2590 96.6650 1 2285 2 chr6A.!!$R1 2284
9 TraesCS3A01G409300 chr5B 524580700 524582173 1473 True 2584.0 2584 98.3040 812 2285 1 chr5B.!!$R2 1473
10 TraesCS3A01G409300 chr5B 332626369 332627190 821 True 1330.0 1330 96.2290 12 816 1 chr5B.!!$R1 804
11 TraesCS3A01G409300 chr5B 267766163 267766973 810 False 1306.0 1306 96.0590 1 795 1 chr5B.!!$F1 794
12 TraesCS3A01G409300 chr2B 673834163 673834996 833 False 1380.0 1380 96.8820 1 816 1 chr2B.!!$F1 815
13 TraesCS3A01G409300 chr2A 470632403 470633236 833 False 1347.0 1347 96.1630 1 816 1 chr2A.!!$F1 815
14 TraesCS3A01G409300 chr1A 3646887 3647719 832 True 1345.0 1345 96.1580 1 816 1 chr1A.!!$R1 815
15 TraesCS3A01G409300 chr5A 617986394 617987226 832 False 1328.0 1328 95.7980 1 816 1 chr5A.!!$F1 815
16 TraesCS3A01G409300 chr1B 602251535 602252202 667 False 1074.0 1074 96.1080 1 650 1 chr1B.!!$F1 649

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
724 760 0.884704 AAAGGCGCCACACTACACAG 60.885 55.0 31.54 0.0 0.0 3.66 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1924 2471 0.744874 CCTTAGGCGCTGCACTACTA 59.255 55.0 7.64 0.0 0.0 1.82 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
406 421 3.181458 TGTGAGGGGACTAATATTTCCGC 60.181 47.826 13.00 13.00 44.43 5.54
632 668 3.312421 TGCACACTGACTTAGCAGTTTTC 59.688 43.478 6.58 0.00 46.42 2.29
704 740 2.821366 CTGTGCAGCGCCTAAGGG 60.821 66.667 2.29 0.00 0.00 3.95
705 741 3.315142 CTGTGCAGCGCCTAAGGGA 62.315 63.158 2.29 0.00 33.58 4.20
724 760 0.884704 AAAGGCGCCACACTACACAG 60.885 55.000 31.54 0.00 0.00 3.66
908 1452 3.994931 AGGGTTAGGGTTATGTGTGTC 57.005 47.619 0.00 0.00 0.00 3.67
1175 1720 1.804151 CGACCGAAAGAAAGCATGGAA 59.196 47.619 0.00 0.00 0.00 3.53
1791 2338 9.221933 ACCATGTCGTACTAATGTTTGAATTAA 57.778 29.630 0.00 0.00 0.00 1.40
1924 2471 2.355010 GCTTTCTGGATAGCCATGGT 57.645 50.000 14.67 2.69 44.91 3.55
2145 2692 3.753272 GGACATGCTAAGCAAAGAGAACA 59.247 43.478 0.00 0.00 43.62 3.18
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
406 421 6.808704 CACATAGGGTCTCACATAATCATACG 59.191 42.308 0.00 0.00 0.00 3.06
632 668 1.156736 CCAGTAGCTTTTCCACCACG 58.843 55.000 0.00 0.00 0.00 4.94
704 740 0.882927 TGTGTAGTGTGGCGCCTTTC 60.883 55.000 29.70 17.99 0.00 2.62
705 741 0.884704 CTGTGTAGTGTGGCGCCTTT 60.885 55.000 29.70 12.66 0.00 3.11
908 1452 5.253330 ACATAACCCTAACACCAACATCAG 58.747 41.667 0.00 0.00 0.00 2.90
1175 1720 2.509964 ACAAAATATCTCCGCCCTTCCT 59.490 45.455 0.00 0.00 0.00 3.36
1791 2338 5.703592 TGCCGACAATGTTCATAACTTAAGT 59.296 36.000 1.12 1.12 0.00 2.24
1808 2355 5.352284 ACAAACACAAATTTTATGCCGACA 58.648 33.333 0.00 0.00 0.00 4.35
1924 2471 0.744874 CCTTAGGCGCTGCACTACTA 59.255 55.000 7.64 0.00 0.00 1.82
2050 2597 3.496515 CCACCCAAAATGGCATCTGTTTT 60.497 43.478 0.00 0.00 35.79 2.43
2109 2656 7.382759 GCTTAGCATGTCCAGTTTATAGTACTC 59.617 40.741 0.00 0.00 0.00 2.59


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.