Multiple sequence alignment - TraesCS3A01G409000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G409000 chr3A 100.000 2723 0 0 1 2723 653824609 653821887 0 5029
1 TraesCS3A01G409000 chr5B 98.570 2728 29 3 1 2723 679660396 679663118 0 4813
2 TraesCS3A01G409000 chrUn 98.535 2730 28 5 1 2723 189394038 189396762 0 4809
3 TraesCS3A01G409000 chr6A 98.424 2728 33 4 1 2723 289130129 289132851 0 4791
4 TraesCS3A01G409000 chr7B 98.387 2728 34 3 1 2723 743087698 743090420 0 4785
5 TraesCS3A01G409000 chr7D 98.352 2730 33 5 1 2723 203554847 203552123 0 4782
6 TraesCS3A01G409000 chr4D 98.314 2728 34 4 1 2723 123414381 123417101 0 4772
7 TraesCS3A01G409000 chr4A 97.836 2726 53 3 4 2723 67586033 67583308 0 4702
8 TraesCS3A01G409000 chr3B 97.837 2728 48 4 1 2723 92201100 92203821 0 4700
9 TraesCS3A01G409000 chr1A 97.691 2728 58 2 1 2723 94773996 94776723 0 4684


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G409000 chr3A 653821887 653824609 2722 True 5029 5029 100.000 1 2723 1 chr3A.!!$R1 2722
1 TraesCS3A01G409000 chr5B 679660396 679663118 2722 False 4813 4813 98.570 1 2723 1 chr5B.!!$F1 2722
2 TraesCS3A01G409000 chrUn 189394038 189396762 2724 False 4809 4809 98.535 1 2723 1 chrUn.!!$F1 2722
3 TraesCS3A01G409000 chr6A 289130129 289132851 2722 False 4791 4791 98.424 1 2723 1 chr6A.!!$F1 2722
4 TraesCS3A01G409000 chr7B 743087698 743090420 2722 False 4785 4785 98.387 1 2723 1 chr7B.!!$F1 2722
5 TraesCS3A01G409000 chr7D 203552123 203554847 2724 True 4782 4782 98.352 1 2723 1 chr7D.!!$R1 2722
6 TraesCS3A01G409000 chr4D 123414381 123417101 2720 False 4772 4772 98.314 1 2723 1 chr4D.!!$F1 2722
7 TraesCS3A01G409000 chr4A 67583308 67586033 2725 True 4702 4702 97.836 4 2723 1 chr4A.!!$R1 2719
8 TraesCS3A01G409000 chr3B 92201100 92203821 2721 False 4700 4700 97.837 1 2723 1 chr3B.!!$F1 2722
9 TraesCS3A01G409000 chr1A 94773996 94776723 2727 False 4684 4684 97.691 1 2723 1 chr1A.!!$F1 2722

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
633 641 0.881159 CCACGCGTTTTCCACCTACA 60.881 55.0 10.22 0.0 0.0 2.74 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2487 2501 1.330829 GAATTCGTTCATCCCTTCGCC 59.669 52.381 0.0 0.0 0.0 5.54 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
80 86 7.659390 AGAGAAAGATTACCGATTCATCCAATC 59.341 37.037 0.00 0.00 38.06 2.67
81 87 6.712547 AGAAAGATTACCGATTCATCCAATCC 59.287 38.462 0.00 0.00 38.17 3.01
82 88 5.567037 AGATTACCGATTCATCCAATCCA 57.433 39.130 0.00 0.00 38.17 3.41
83 89 5.940617 AGATTACCGATTCATCCAATCCAA 58.059 37.500 0.00 0.00 38.17 3.53
84 90 6.546484 AGATTACCGATTCATCCAATCCAAT 58.454 36.000 0.00 0.00 38.17 3.16
111 117 8.086522 CCAATTTGATCAGAAGTGAGTTCATTT 58.913 33.333 15.09 0.00 37.67 2.32
120 126 8.735315 TCAGAAGTGAGTTCATTTTTGTTGTAA 58.265 29.630 2.50 0.00 37.67 2.41
185 191 3.181491 GCCGAGCTATCTATCCAGATCAC 60.181 52.174 0.00 0.00 40.81 3.06
633 641 0.881159 CCACGCGTTTTCCACCTACA 60.881 55.000 10.22 0.00 0.00 2.74
787 795 7.234187 CGAGAGCAGCATAATTGTTAGTTAA 57.766 36.000 0.00 0.00 0.00 2.01
1681 1691 1.856629 TCCCGAATCTCCCTTAACGT 58.143 50.000 0.00 0.00 0.00 3.99
1836 1846 3.983044 AAAGTAGGTTCGATTCCTGCT 57.017 42.857 17.32 17.32 46.85 4.24
1939 1949 6.441088 AAGTGAATCCCTCTAACACTTCTT 57.559 37.500 0.00 0.00 44.75 2.52
2142 2153 6.435292 AATAGGTAAAGGAAGGCGTATCAT 57.565 37.500 0.00 0.00 0.00 2.45
2214 2225 3.296628 ACATGAACACAAACGAAATCGC 58.703 40.909 0.00 0.00 44.43 4.58
2355 2366 2.184533 TCCCTGCGAGTGAAGGATTTA 58.815 47.619 0.00 0.00 44.93 1.40
2487 2501 0.384669 GTACTCGACCAATCCTCGGG 59.615 60.000 0.00 0.00 37.65 5.14
2546 2560 3.076621 GAGGTCAGCATCACATGAAACA 58.923 45.455 0.00 0.00 0.00 2.83
2591 2605 1.668826 TGGAGTATGGCTGGAAGGTT 58.331 50.000 0.00 0.00 0.00 3.50
2685 2699 8.044908 GGTACCTATATTCCTGAAACAAGACAA 58.955 37.037 4.06 0.00 0.00 3.18
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
13 14 1.153369 GCTGTATTGAGAGCGGGCA 60.153 57.895 0.00 0.00 31.42 5.36
80 86 6.152323 ACTCACTTCTGATCAAATTGGATTGG 59.848 38.462 0.00 0.00 0.00 3.16
81 87 7.154435 ACTCACTTCTGATCAAATTGGATTG 57.846 36.000 0.00 0.00 0.00 2.67
82 88 7.449395 TGAACTCACTTCTGATCAAATTGGATT 59.551 33.333 0.00 0.00 0.00 3.01
83 89 6.944290 TGAACTCACTTCTGATCAAATTGGAT 59.056 34.615 0.00 0.00 0.00 3.41
84 90 6.298361 TGAACTCACTTCTGATCAAATTGGA 58.702 36.000 0.00 0.00 0.00 3.53
111 117 5.103687 GGAAAGGTTTCGCTTTACAACAAA 58.896 37.500 0.00 0.00 38.06 2.83
120 126 2.650322 TGTCAAGGAAAGGTTTCGCTT 58.350 42.857 0.00 0.00 38.06 4.68
185 191 0.179225 CCATTCGCTTCGTTCAACCG 60.179 55.000 0.00 0.00 0.00 4.44
633 641 6.500049 AGGATATTTCGATGATTTCTCCCTCT 59.500 38.462 0.00 0.00 0.00 3.69
787 795 2.367378 CCCGTCCCCTCTTACCCT 59.633 66.667 0.00 0.00 0.00 4.34
1358 1368 0.981183 TAAACGAGCATCCCACACCT 59.019 50.000 0.00 0.00 0.00 4.00
1681 1691 7.406031 TTCCTTCTCGAGCTTCTATTTCTTA 57.594 36.000 7.81 0.00 0.00 2.10
1803 1813 6.097129 TCGAACCTACTTTTTGACCCATTTTT 59.903 34.615 0.00 0.00 0.00 1.94
1836 1846 2.305635 TCTTTAAGAGGCAGTGCATCCA 59.694 45.455 25.10 11.59 40.43 3.41
2355 2366 6.049955 TCAAGAGGTTTTTCTCCATACGAT 57.950 37.500 0.00 0.00 34.46 3.73
2487 2501 1.330829 GAATTCGTTCATCCCTTCGCC 59.669 52.381 0.00 0.00 0.00 5.54
2546 2560 6.998074 TCCAATATCGAATGGAAGTGCTAAAT 59.002 34.615 13.67 0.00 42.61 1.40
2591 2605 4.276183 CGATTGACAAGACTAGCTAGGCTA 59.724 45.833 29.49 14.03 41.95 3.93
2685 2699 7.177392 CCAAAATAGAAGGTCTTCATGAAGGTT 59.823 37.037 30.33 21.81 41.84 3.50


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.