Multiple sequence alignment - TraesCS3A01G405800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G405800 chr3A 100.000 2433 0 0 1 2433 650015966 650013534 0 4494
1 TraesCS3A01G405800 chr3A 98.276 2436 38 4 1 2433 66006586 66004152 0 4263
2 TraesCS3A01G405800 chr3A 97.782 2435 52 2 1 2433 695638934 695641368 0 4196
3 TraesCS3A01G405800 chr6D 98.440 2436 35 3 1 2433 389247276 389244841 0 4285
4 TraesCS3A01G405800 chr7B 98.276 2436 39 3 1 2433 663100879 663098444 0 4263
5 TraesCS3A01G405800 chr7B 98.194 2436 41 3 1 2433 662724950 662727385 0 4252
6 TraesCS3A01G405800 chr5D 98.276 2436 39 3 1 2433 503243818 503246253 0 4263
7 TraesCS3A01G405800 chr2A 98.194 2436 41 3 1 2433 726907909 726905474 0 4252
8 TraesCS3A01G405800 chr3D 98.071 2436 41 5 1 2433 589264977 589262545 0 4233
9 TraesCS3A01G405800 chr3B 97.948 2437 46 4 1 2433 201538067 201540503 0 4220


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G405800 chr3A 650013534 650015966 2432 True 4494 4494 100.000 1 2433 1 chr3A.!!$R2 2432
1 TraesCS3A01G405800 chr3A 66004152 66006586 2434 True 4263 4263 98.276 1 2433 1 chr3A.!!$R1 2432
2 TraesCS3A01G405800 chr3A 695638934 695641368 2434 False 4196 4196 97.782 1 2433 1 chr3A.!!$F1 2432
3 TraesCS3A01G405800 chr6D 389244841 389247276 2435 True 4285 4285 98.440 1 2433 1 chr6D.!!$R1 2432
4 TraesCS3A01G405800 chr7B 663098444 663100879 2435 True 4263 4263 98.276 1 2433 1 chr7B.!!$R1 2432
5 TraesCS3A01G405800 chr7B 662724950 662727385 2435 False 4252 4252 98.194 1 2433 1 chr7B.!!$F1 2432
6 TraesCS3A01G405800 chr5D 503243818 503246253 2435 False 4263 4263 98.276 1 2433 1 chr5D.!!$F1 2432
7 TraesCS3A01G405800 chr2A 726905474 726907909 2435 True 4252 4252 98.194 1 2433 1 chr2A.!!$R1 2432
8 TraesCS3A01G405800 chr3D 589262545 589264977 2432 True 4233 4233 98.071 1 2433 1 chr3D.!!$R1 2432
9 TraesCS3A01G405800 chr3B 201538067 201540503 2436 False 4220 4220 97.948 1 2433 1 chr3B.!!$F1 2432

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
87 88 0.950555 GATGTCGTCAGCTTGTGCCA 60.951 55.0 0.0 0.0 40.8 4.92 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1597 1605 0.036164 AACGCAGCATACAACTCCCA 59.964 50.0 0.0 0.0 0.0 4.37 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
87 88 0.950555 GATGTCGTCAGCTTGTGCCA 60.951 55.000 0.00 0.0 40.80 4.92
301 302 3.219281 GTGAGCTAACTCCAAAAACCCA 58.781 45.455 0.00 0.0 42.74 4.51
361 362 6.544928 TGAAGCAGGAATCACTAGTAATCA 57.455 37.500 0.00 0.0 0.00 2.57
513 514 4.175787 GACTGGAGTGAAGTCGTAACAT 57.824 45.455 0.00 0.0 35.12 2.71
554 555 1.614317 CGGCTGGATCACCTCCTTTTT 60.614 52.381 0.00 0.0 45.21 1.94
1003 1005 2.804986 TCCAAGGCACATTAGCATGA 57.195 45.000 0.00 0.0 35.83 3.07
1004 1006 3.084536 TCCAAGGCACATTAGCATGAA 57.915 42.857 0.00 0.0 35.83 2.57
1026 1028 4.087182 AGTACTCCTCCTGTTTGAATCGA 58.913 43.478 0.00 0.0 0.00 3.59
1597 1605 2.224066 ACTTGAAGAGCGCAGTACAACT 60.224 45.455 11.47 0.0 0.00 3.16
1927 1935 2.039879 ACCGGTGGCTCACTTTTTCTAT 59.960 45.455 6.12 0.0 34.40 1.98
2222 2230 2.237965 CCCCATTGTCTCCACCCCA 61.238 63.158 0.00 0.0 0.00 4.96
2416 2424 1.683441 GGCGGAAAAAGGGGAGAGA 59.317 57.895 0.00 0.0 0.00 3.10
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
69 70 1.071299 TGGCACAAGCTGACGACAT 59.929 52.632 0.00 0.00 41.70 3.06
87 88 4.828829 CGAGACTTAACCCAACACCTTAT 58.171 43.478 0.00 0.00 0.00 1.73
266 267 2.437895 TCACCCTCGCGAGATCGT 60.438 61.111 36.59 24.52 42.22 3.73
351 352 1.755380 GGCTGACCGGTGATTACTAGT 59.245 52.381 14.63 0.00 0.00 2.57
394 395 1.599797 GGCGGTGTGTACAAGGCTT 60.600 57.895 0.00 0.00 0.00 4.35
395 396 2.032071 GGCGGTGTGTACAAGGCT 59.968 61.111 0.00 0.00 0.00 4.58
513 514 0.251922 ACCTTCCAGTACGGCTACCA 60.252 55.000 0.00 0.00 33.14 3.25
966 968 3.713902 ATGATCCACATCTTCGGGC 57.286 52.632 0.00 0.00 33.46 6.13
1003 1005 4.527038 TCGATTCAAACAGGAGGAGTACTT 59.473 41.667 0.00 0.00 0.00 2.24
1004 1006 4.087182 TCGATTCAAACAGGAGGAGTACT 58.913 43.478 0.00 0.00 0.00 2.73
1553 1561 1.675007 CTTCTTCCCCCTTCTCCCTT 58.325 55.000 0.00 0.00 0.00 3.95
1597 1605 0.036164 AACGCAGCATACAACTCCCA 59.964 50.000 0.00 0.00 0.00 4.37
1927 1935 3.199442 TCAGTCCTCTTCCCCATTACA 57.801 47.619 0.00 0.00 0.00 2.41
2222 2230 3.117246 TGGGGTGATCTCGTAGTTCCTAT 60.117 47.826 0.00 0.00 0.00 2.57
2268 2276 1.436336 GTCTATGGTCGGTCCGTGG 59.564 63.158 11.88 0.00 39.52 4.94
2315 2323 3.470888 CCCAACCGGAGAGCGGAT 61.471 66.667 9.46 0.00 0.00 4.18


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.