Multiple sequence alignment - TraesCS3A01G387100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G387100 chr3A 100.000 2519 0 0 1 2519 636533342 636530824 0.000000e+00 4652
1 TraesCS3A01G387100 chr5A 97.994 2293 37 6 1 2286 650150680 650152970 0.000000e+00 3971
2 TraesCS3A01G387100 chr5A 98.723 235 3 0 2285 2519 650153567 650153801 3.880000e-113 418
3 TraesCS3A01G387100 chr2A 97.948 2291 42 3 1 2286 769227788 769230078 0.000000e+00 3965
4 TraesCS3A01G387100 chr2A 97.727 2288 49 3 1 2286 115130165 115132451 0.000000e+00 3934
5 TraesCS3A01G387100 chr2A 98.723 235 3 0 2285 2519 769239248 769239482 3.880000e-113 418
6 TraesCS3A01G387100 chr2A 97.021 235 4 3 2285 2519 115133027 115133258 2.350000e-105 392
7 TraesCS3A01G387100 chr4A 97.684 2288 50 3 1 2286 604389250 604386964 0.000000e+00 3928
8 TraesCS3A01G387100 chr4A 98.298 235 4 0 2285 2519 521948326 521948560 1.800000e-111 412
9 TraesCS3A01G387100 chr4A 97.872 235 5 0 2285 2519 604386343 604386109 8.390000e-110 407
10 TraesCS3A01G387100 chr6A 97.472 2294 46 5 1 2286 162654541 162656830 0.000000e+00 3904
11 TraesCS3A01G387100 chr6A 98.298 235 4 0 2285 2519 162657439 162657673 1.800000e-111 412
12 TraesCS3A01G387100 chr4B 93.302 2329 88 17 7 2286 657805300 657802991 0.000000e+00 3374
13 TraesCS3A01G387100 chr7D 93.750 2240 97 18 74 2286 92234276 92232053 0.000000e+00 3321
14 TraesCS3A01G387100 chr7D 93.619 2241 94 23 74 2286 631818323 631816104 0.000000e+00 3301
15 TraesCS3A01G387100 chr3D 93.851 2228 95 16 87 2286 45062954 45060741 0.000000e+00 3317
16 TraesCS3A01G387100 chr3D 96.170 235 9 0 2285 2519 160919996 160920230 3.930000e-103 385
17 TraesCS3A01G387100 chr2B 96.359 824 29 1 1 823 69352189 69353012 0.000000e+00 1354
18 TraesCS3A01G387100 chr2B 95.030 825 39 2 1 823 23131290 23132114 0.000000e+00 1295
19 TraesCS3A01G387100 chr6B 96.121 825 30 2 1 823 661539094 661539918 0.000000e+00 1345
20 TraesCS3A01G387100 chr7B 95.889 827 30 3 1 823 41047188 41048014 0.000000e+00 1336
21 TraesCS3A01G387100 chr4D 96.170 235 9 0 2285 2519 391458553 391458787 3.930000e-103 385
22 TraesCS3A01G387100 chr1D 96.170 235 9 0 2285 2519 30070836 30070602 3.930000e-103 385


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G387100 chr3A 636530824 636533342 2518 True 4652.0 4652 100.0000 1 2519 1 chr3A.!!$R1 2518
1 TraesCS3A01G387100 chr5A 650150680 650153801 3121 False 2194.5 3971 98.3585 1 2519 2 chr5A.!!$F1 2518
2 TraesCS3A01G387100 chr2A 769227788 769230078 2290 False 3965.0 3965 97.9480 1 2286 1 chr2A.!!$F1 2285
3 TraesCS3A01G387100 chr2A 115130165 115133258 3093 False 2163.0 3934 97.3740 1 2519 2 chr2A.!!$F3 2518
4 TraesCS3A01G387100 chr4A 604386109 604389250 3141 True 2167.5 3928 97.7780 1 2519 2 chr4A.!!$R1 2518
5 TraesCS3A01G387100 chr6A 162654541 162657673 3132 False 2158.0 3904 97.8850 1 2519 2 chr6A.!!$F1 2518
6 TraesCS3A01G387100 chr4B 657802991 657805300 2309 True 3374.0 3374 93.3020 7 2286 1 chr4B.!!$R1 2279
7 TraesCS3A01G387100 chr7D 92232053 92234276 2223 True 3321.0 3321 93.7500 74 2286 1 chr7D.!!$R1 2212
8 TraesCS3A01G387100 chr7D 631816104 631818323 2219 True 3301.0 3301 93.6190 74 2286 1 chr7D.!!$R2 2212
9 TraesCS3A01G387100 chr3D 45060741 45062954 2213 True 3317.0 3317 93.8510 87 2286 1 chr3D.!!$R1 2199
10 TraesCS3A01G387100 chr2B 69352189 69353012 823 False 1354.0 1354 96.3590 1 823 1 chr2B.!!$F2 822
11 TraesCS3A01G387100 chr2B 23131290 23132114 824 False 1295.0 1295 95.0300 1 823 1 chr2B.!!$F1 822
12 TraesCS3A01G387100 chr6B 661539094 661539918 824 False 1345.0 1345 96.1210 1 823 1 chr6B.!!$F1 822
13 TraesCS3A01G387100 chr7B 41047188 41048014 826 False 1336.0 1336 95.8890 1 823 1 chr7B.!!$F1 822

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
43 44 1.217244 CGGTCGGAACTGGGGTAAG 59.783 63.158 0.00 0.0 0.00 2.34 F
253 271 1.352017 AGGTTGTCAGCATGGACATGA 59.648 47.619 15.99 0.0 46.37 3.07 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1449 1499 2.100605 ACCCTTCTTTTAGCAGCTCG 57.899 50.0 0.0 0.0 0.0 5.03 R
2061 2121 0.690411 CCTCCTCCTCCTCTGTGCAT 60.690 60.0 0.0 0.0 0.0 3.96 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
43 44 1.217244 CGGTCGGAACTGGGGTAAG 59.783 63.158 0.00 0.0 0.00 2.34
253 271 1.352017 AGGTTGTCAGCATGGACATGA 59.648 47.619 15.99 0.0 46.37 3.07
747 792 7.030768 CAGTGATGTTTGATATGATGCAACAA 58.969 34.615 0.00 0.0 0.00 2.83
1449 1499 2.890941 GCTTGAGCTTGTTGTTGCC 58.109 52.632 0.00 0.0 38.21 4.52
1905 1965 3.053826 CCCTAGGCCTACTAAACCCAAT 58.946 50.000 8.91 0.0 0.00 3.16
2061 2121 0.898320 GAGGTTAGGACAGCAGCAGA 59.102 55.000 0.00 0.0 0.00 4.26
2142 2208 0.250295 CAAGAGGAGTTCAACCGCCA 60.250 55.000 0.29 0.0 0.00 5.69
2240 2307 2.981784 TCATGGAGATCATTAGGTGGGG 59.018 50.000 0.00 0.0 32.92 4.96
2276 2343 0.183014 ATGGCTCCTCATCCAGCAAG 59.817 55.000 0.00 0.0 37.38 4.01
2366 3100 3.576078 TGATGACCTGGTGTTCTTTGT 57.424 42.857 2.82 0.0 0.00 2.83
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
253 271 5.705905 GTGGCAAAGAACTTACCATAAGTCT 59.294 40.000 10.81 0.00 33.36 3.24
1449 1499 2.100605 ACCCTTCTTTTAGCAGCTCG 57.899 50.000 0.00 0.00 0.00 5.03
1905 1965 2.520188 ATTGAGAGATGGATGGGGGA 57.480 50.000 0.00 0.00 0.00 4.81
2061 2121 0.690411 CCTCCTCCTCCTCTGTGCAT 60.690 60.000 0.00 0.00 0.00 3.96
2142 2208 3.314693 TCCAGTACCTTGTTGGAGAGTT 58.685 45.455 0.00 0.00 36.13 3.01
2240 2307 2.856222 CCATGACTGCCCTAATCCTTC 58.144 52.381 0.00 0.00 0.00 3.46
2276 2343 2.019156 GCACTGGATCTTTGGCCCTAC 61.019 57.143 0.00 0.00 0.00 3.18
2366 3100 4.592942 CAATGGATCAAGGTCTTCTCCAA 58.407 43.478 12.67 2.01 35.97 3.53


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.