Multiple sequence alignment - TraesCS3A01G384100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G384100 chr3A 100.000 3215 0 0 1 3215 633111333 633114547 0 5938
1 TraesCS3A01G384100 chr4D 99.037 3219 27 3 1 3215 123299969 123303187 0 5770
2 TraesCS3A01G384100 chr7B 98.912 3218 32 3 1 3215 644467523 644470740 0 5746
3 TraesCS3A01G384100 chr7D 98.696 3221 36 4 1 3215 203515555 203518775 0 5710
4 TraesCS3A01G384100 chr6B 98.230 3221 51 3 1 3215 306995911 306992691 0 5627
5 TraesCS3A01G384100 chr1B 98.169 3223 49 6 1 3215 638700587 638697367 0 5616
6 TraesCS3A01G384100 chr1B 97.948 3217 64 2 1 3215 672479240 672482456 0 5574
7 TraesCS3A01G384100 chr4B 97.980 3218 62 2 1 3215 209077439 209074222 0 5579
8 TraesCS3A01G384100 chr2A 97.918 3218 62 4 1 3215 332944218 332941003 0 5566
9 TraesCS3A01G384100 chr2B 97.795 3220 66 4 1 3215 391112762 391109543 0 5548


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G384100 chr3A 633111333 633114547 3214 False 5938 5938 100.000 1 3215 1 chr3A.!!$F1 3214
1 TraesCS3A01G384100 chr4D 123299969 123303187 3218 False 5770 5770 99.037 1 3215 1 chr4D.!!$F1 3214
2 TraesCS3A01G384100 chr7B 644467523 644470740 3217 False 5746 5746 98.912 1 3215 1 chr7B.!!$F1 3214
3 TraesCS3A01G384100 chr7D 203515555 203518775 3220 False 5710 5710 98.696 1 3215 1 chr7D.!!$F1 3214
4 TraesCS3A01G384100 chr6B 306992691 306995911 3220 True 5627 5627 98.230 1 3215 1 chr6B.!!$R1 3214
5 TraesCS3A01G384100 chr1B 638697367 638700587 3220 True 5616 5616 98.169 1 3215 1 chr1B.!!$R1 3214
6 TraesCS3A01G384100 chr1B 672479240 672482456 3216 False 5574 5574 97.948 1 3215 1 chr1B.!!$F1 3214
7 TraesCS3A01G384100 chr4B 209074222 209077439 3217 True 5579 5579 97.980 1 3215 1 chr4B.!!$R1 3214
8 TraesCS3A01G384100 chr2A 332941003 332944218 3215 True 5566 5566 97.918 1 3215 1 chr2A.!!$R1 3214
9 TraesCS3A01G384100 chr2B 391109543 391112762 3219 True 5548 5548 97.795 1 3215 1 chr2B.!!$R1 3214

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
543 547 1.075374 CCCTGACTCCATCCCAAACAA 59.925 52.381 0.00 0.0 0.0 2.83 F
1698 1714 0.740868 CACGATCGGGCATGAGTGTT 60.741 55.000 20.98 0.0 0.0 3.32 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1961 1978 2.218603 CTTGGTAAAGGTTGTCGCAGT 58.781 47.619 0.0 0.0 0.00 4.40 R
3193 3214 0.905357 AGCATTCAGTTAGAGGCGGT 59.095 50.000 0.0 0.0 34.64 5.68 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
57 58 1.376037 CGCCTCCTCTTGGTTGGTC 60.376 63.158 0.00 0.0 33.23 4.02
543 547 1.075374 CCCTGACTCCATCCCAAACAA 59.925 52.381 0.00 0.0 0.00 2.83
777 781 1.609208 AAGAGCATCCAACGCAAAGT 58.391 45.000 0.00 0.0 33.66 2.66
1698 1714 0.740868 CACGATCGGGCATGAGTGTT 60.741 55.000 20.98 0.0 0.00 3.32
1961 1978 4.110072 AGTCCTCTGTCCTACTACAGGTA 58.890 47.826 4.32 0.0 45.69 3.08
2191 2208 3.856508 CGAACAACGACGGAGCAT 58.143 55.556 0.00 0.0 45.77 3.79
2340 2360 3.086733 GGCTGAAGGCTTCGCTATT 57.913 52.632 29.12 0.0 41.46 1.73
2731 2752 1.626356 GCTGCATCCCTACTCACCCA 61.626 60.000 0.00 0.0 0.00 4.51
3193 3214 3.289704 TTCGGCGAACCTGCGATCA 62.290 57.895 19.83 0.0 35.06 2.92
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
332 336 1.938585 TCTTTGATCCGTCTGAGGGT 58.061 50.000 15.40 4.07 0.00 4.34
543 547 3.074985 TGGTAGGGCCGATAGTAGTACAT 59.925 47.826 2.52 0.00 41.21 2.29
777 781 3.568007 CGAAACAAGGGAATGAAAGGTCA 59.432 43.478 0.00 0.00 38.41 4.02
1216 1232 4.444449 GGATTGTAGGAAGTGGGTGATACC 60.444 50.000 0.00 0.00 37.60 2.73
1698 1714 8.380742 AGGGAGTATACAATTTCTTCTTCAGA 57.619 34.615 5.50 0.00 0.00 3.27
1961 1978 2.218603 CTTGGTAAAGGTTGTCGCAGT 58.781 47.619 0.00 0.00 0.00 4.40
2223 2240 6.128007 CGCCTGTTCACTAAAATCCAAATAGT 60.128 38.462 0.00 0.00 0.00 2.12
2239 2257 3.394674 TCTCATGTAAACGCCTGTTCA 57.605 42.857 0.00 0.00 37.31 3.18
2629 2650 3.500448 TCTGAGACTCTCGCCTCATAT 57.500 47.619 3.68 0.00 38.57 1.78
3193 3214 0.905357 AGCATTCAGTTAGAGGCGGT 59.095 50.000 0.00 0.00 34.64 5.68


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.