Multiple sequence alignment - TraesCS3A01G384000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G384000 chr3A 100.000 2636 0 0 1 2636 633106746 633109381 0 4868
1 TraesCS3A01G384000 chr7B 98.938 2637 27 1 1 2636 644462934 644465570 0 4713
2 TraesCS3A01G384000 chrUn 98.863 2638 27 3 1 2636 189406574 189409210 0 4702
3 TraesCS3A01G384000 chrUn 98.560 2638 34 4 1 2636 251410021 251407386 0 4658
4 TraesCS3A01G384000 chr1B 98.749 2637 31 2 1 2636 668809669 668807034 0 4686
5 TraesCS3A01G384000 chr6D 98.560 2638 33 4 1 2636 124531612 124534246 0 4656
6 TraesCS3A01G384000 chr7D 98.370 2638 37 6 1 2636 626683745 626681112 0 4628
7 TraesCS3A01G384000 chr4B 97.952 2637 50 4 1 2636 209082023 209079390 0 4567


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G384000 chr3A 633106746 633109381 2635 False 4868 4868 100.000 1 2636 1 chr3A.!!$F1 2635
1 TraesCS3A01G384000 chr7B 644462934 644465570 2636 False 4713 4713 98.938 1 2636 1 chr7B.!!$F1 2635
2 TraesCS3A01G384000 chrUn 189406574 189409210 2636 False 4702 4702 98.863 1 2636 1 chrUn.!!$F1 2635
3 TraesCS3A01G384000 chrUn 251407386 251410021 2635 True 4658 4658 98.560 1 2636 1 chrUn.!!$R1 2635
4 TraesCS3A01G384000 chr1B 668807034 668809669 2635 True 4686 4686 98.749 1 2636 1 chr1B.!!$R1 2635
5 TraesCS3A01G384000 chr6D 124531612 124534246 2634 False 4656 4656 98.560 1 2636 1 chr6D.!!$F1 2635
6 TraesCS3A01G384000 chr7D 626681112 626683745 2633 True 4628 4628 98.370 1 2636 1 chr7D.!!$R1 2635
7 TraesCS3A01G384000 chr4B 209079390 209082023 2633 True 4567 4567 97.952 1 2636 1 chr4B.!!$R1 2635

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
521 522 0.179468 GCCTCGGGTATTAGCCACAA 59.821 55.0 12.21 0.0 34.89 3.33 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2440 2445 1.367346 TCAGAAACCACCAGGCCATA 58.633 50.0 5.01 0.0 39.06 2.74 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
207 208 3.129502 GCTCATGCAGCTTCGGCA 61.130 61.111 0.00 0.00 45.83 5.69
228 229 2.688364 CGCTTTTTCGCCTTCTCTTT 57.312 45.000 0.00 0.00 0.00 2.52
456 457 3.459227 TGGGCTCATCATGAATTAGGTCA 59.541 43.478 0.00 0.00 0.00 4.02
521 522 0.179468 GCCTCGGGTATTAGCCACAA 59.821 55.000 12.21 0.00 34.89 3.33
595 596 8.868522 TTCTGAATATTTTGACTCTTCCATGT 57.131 30.769 0.00 0.00 0.00 3.21
686 687 6.479001 CGATACACGAGGAAGATTTTTATGGT 59.521 38.462 0.00 0.00 45.77 3.55
788 789 1.981256 AAAAGAGATGGTTGTGGCGT 58.019 45.000 0.00 0.00 0.00 5.68
949 950 0.318441 CTTCGGAAGTCACTCTGGCA 59.682 55.000 9.61 0.00 0.00 4.92
1363 1366 0.178932 ATCCCTGGATGTAGCGGCTA 60.179 55.000 5.42 5.42 32.98 3.93
1433 1436 5.882557 GGATAGAACTGAAGAAGATTTGGCA 59.117 40.000 0.00 0.00 0.00 4.92
2172 2175 3.838244 ACCCGCTTGCTTATCTTCATA 57.162 42.857 0.00 0.00 0.00 2.15
2522 2527 5.964477 TGATCTGGTCCTACCTTTTGTCTAT 59.036 40.000 0.00 0.00 39.58 1.98
2583 2588 5.124776 TCCGGATAAATTGGAACACATTGAC 59.875 40.000 0.00 0.00 39.29 3.18
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
228 229 4.074526 GCGCTCCTGTCCAGAGCA 62.075 66.667 12.74 0.00 41.64 4.26
456 457 2.520968 GAAACCACCAGCCACCCT 59.479 61.111 0.00 0.00 0.00 4.34
521 522 8.142551 GGGTAGAATTACTGAATGAATACGAGT 58.857 37.037 0.00 0.00 0.00 4.18
595 596 7.041644 CGTATTGAAAAGGTTCCTAAGACACAA 60.042 37.037 0.00 0.00 32.28 3.33
686 687 5.013704 TGCCTGTAATTAGAAGGAAGAACCA 59.986 40.000 15.45 3.28 42.04 3.67
788 789 3.305131 CGTAGGTGCACAAGAGTACTTCA 60.305 47.826 20.43 0.00 33.70 3.02
949 950 0.533755 GAAGTATCCAGCAGCGCCAT 60.534 55.000 2.29 0.00 0.00 4.40
1323 1326 6.609616 GGGATCCCACAAAATCATTAAACCTA 59.390 38.462 26.95 0.00 35.81 3.08
1433 1436 4.464951 ACCCTTTGACCTTTTTCTTCGTTT 59.535 37.500 0.00 0.00 0.00 3.60
1958 1961 1.481056 AAGGACTGACGTCTTGGGGG 61.481 60.000 17.92 2.83 40.10 5.40
1999 2002 4.440808 TGGAAGGGGGATTCAGTAAACTA 58.559 43.478 0.00 0.00 0.00 2.24
2440 2445 1.367346 TCAGAAACCACCAGGCCATA 58.633 50.000 5.01 0.00 39.06 2.74
2583 2588 2.434359 GGGCAGGAACGAACGGAG 60.434 66.667 0.00 0.00 0.00 4.63


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.