Multiple sequence alignment - TraesCS3A01G378500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G378500 chr3A 100.000 2285 0 0 1 2285 627956949 627954665 0 4220
1 TraesCS3A01G378500 chr3A 98.862 2285 24 2 1 2285 514528941 514531223 0 4074
2 TraesCS3A01G378500 chr6A 98.731 2285 29 0 1 2285 214163117 214160833 0 4060
3 TraesCS3A01G378500 chr6B 98.643 2285 30 1 1 2285 439442973 439440690 0 4047
4 TraesCS3A01G378500 chr7A 98.468 2285 35 0 1 2285 613755276 613752992 0 4026
5 TraesCS3A01G378500 chr7B 98.163 2286 39 2 1 2285 577195719 577193436 0 3986
6 TraesCS3A01G378500 chr1A 98.073 2283 44 0 3 2285 64891384 64889102 0 3973
7 TraesCS3A01G378500 chr5B 98.206 2118 26 2 115 2232 255655796 255657901 0 3690
8 TraesCS3A01G378500 chr5B 98.615 1949 27 0 337 2285 524582648 524580700 0 3450
9 TraesCS3A01G378500 chr1B 95.522 2233 76 9 1 2232 631842863 631845072 0 3548
10 TraesCS3A01G378500 chr2B 96.860 414 9 3 1 412 708697863 708697452 0 689


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G378500 chr3A 627954665 627956949 2284 True 4220 4220 100.000 1 2285 1 chr3A.!!$R1 2284
1 TraesCS3A01G378500 chr3A 514528941 514531223 2282 False 4074 4074 98.862 1 2285 1 chr3A.!!$F1 2284
2 TraesCS3A01G378500 chr6A 214160833 214163117 2284 True 4060 4060 98.731 1 2285 1 chr6A.!!$R1 2284
3 TraesCS3A01G378500 chr6B 439440690 439442973 2283 True 4047 4047 98.643 1 2285 1 chr6B.!!$R1 2284
4 TraesCS3A01G378500 chr7A 613752992 613755276 2284 True 4026 4026 98.468 1 2285 1 chr7A.!!$R1 2284
5 TraesCS3A01G378500 chr7B 577193436 577195719 2283 True 3986 3986 98.163 1 2285 1 chr7B.!!$R1 2284
6 TraesCS3A01G378500 chr1A 64889102 64891384 2282 True 3973 3973 98.073 3 2285 1 chr1A.!!$R1 2282
7 TraesCS3A01G378500 chr5B 255655796 255657901 2105 False 3690 3690 98.206 115 2232 1 chr5B.!!$F1 2117
8 TraesCS3A01G378500 chr5B 524580700 524582648 1948 True 3450 3450 98.615 337 2285 1 chr5B.!!$R1 1948
9 TraesCS3A01G378500 chr1B 631842863 631845072 2209 False 3548 3548 95.522 1 2232 1 chr1B.!!$F1 2231

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
561 563 1.450134 CTTGGGCGCTGCACATCTA 60.45 57.895 7.64 0.0 43.39 1.98 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1958 1961 0.108615 CTTAGGCGCTGCACTGTACT 60.109 55.0 7.64 0.0 0.0 2.73 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
561 563 1.450134 CTTGGGCGCTGCACATCTA 60.450 57.895 7.64 0.0 43.39 1.98
580 582 7.389884 CACATCTAGACATTTATTAGGCTGCAT 59.610 37.037 0.50 0.0 0.00 3.96
753 756 4.021016 CCCTTAAGGTAATCTCCTCCGATG 60.021 50.000 20.22 0.0 36.74 3.84
763 766 1.521681 CCTCCGATGCCCTCGTTTC 60.522 63.158 5.24 0.0 46.18 2.78
836 839 8.950007 AAACCCTAGTTTTTGATAGGATTTGA 57.050 30.769 0.00 0.0 43.82 2.69
1184 1187 2.424842 AAAGCATGGACGGAAGGGCA 62.425 55.000 0.00 0.0 0.00 5.36
1977 1980 0.108615 AGTACAGTGCAGCGCCTAAG 60.109 55.000 2.29 0.0 0.00 2.18
1978 1981 1.084370 GTACAGTGCAGCGCCTAAGG 61.084 60.000 2.29 0.0 0.00 2.69
1981 1984 1.987855 AGTGCAGCGCCTAAGGGTA 60.988 57.895 2.29 0.0 34.45 3.69
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
189 191 2.046314 TGGCGCCTTGACCTTAGC 60.046 61.111 29.70 0.00 0.0 3.09
536 538 2.034066 CAGCGCCCAAGGGAAAGA 59.966 61.111 9.92 0.00 37.5 2.52
561 563 6.125029 AGTTGATGCAGCCTAATAAATGTCT 58.875 36.000 0.00 0.00 0.0 3.41
580 582 0.914417 GATGGGTGGGAGGGAGTTGA 60.914 60.000 0.00 0.00 0.0 3.18
753 756 1.543429 CCTATGGATGGAAACGAGGGC 60.543 57.143 0.00 0.00 0.0 5.19
763 766 6.509656 CAAATGTGACAATTCCTATGGATGG 58.490 40.000 0.00 0.00 0.0 3.51
1184 1187 5.930135 AGTTCGGGCATACAAAATATCTCT 58.070 37.500 0.00 0.00 0.0 3.10
1958 1961 0.108615 CTTAGGCGCTGCACTGTACT 60.109 55.000 7.64 0.00 0.0 2.73
1977 1980 4.778143 CTGTGTGGCGCCCTACCC 62.778 72.222 26.77 8.37 0.0 3.69
1978 1981 2.652095 TACTGTGTGGCGCCCTACC 61.652 63.158 26.77 9.88 0.0 3.18
1981 1984 3.238497 TGTACTGTGTGGCGCCCT 61.238 61.111 26.77 1.74 0.0 5.19


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.