Multiple sequence alignment - TraesCS3A01G368300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G368300 chr3A 100.000 3156 0 0 1 3156 617230009 617226854 0.000000e+00 5829
1 TraesCS3A01G368300 chr3A 97.591 3155 63 5 2 3156 617271932 617268791 0.000000e+00 5393
2 TraesCS3A01G368300 chr3A 91.207 1740 76 16 1 1685 62482095 62483812 0.000000e+00 2294
3 TraesCS3A01G368300 chr3A 94.544 1283 68 2 1676 2956 535604949 535606231 0.000000e+00 1980
4 TraesCS3A01G368300 chr3A 95.074 203 10 0 2952 3154 535606258 535606460 1.410000e-83 320
5 TraesCS3A01G368300 chr2A 96.647 3161 95 7 2 3156 728981167 728984322 0.000000e+00 5240
6 TraesCS3A01G368300 chr2A 93.099 1623 81 10 1 1597 697151027 697152644 0.000000e+00 2348
7 TraesCS3A01G368300 chr2A 95.008 1282 63 1 1676 2956 697152834 697154115 0.000000e+00 2012
8 TraesCS3A01G368300 chr2A 95.122 205 10 0 2952 3156 53572578 53572374 1.090000e-84 324
9 TraesCS3A01G368300 chr1A 96.516 3157 109 1 1 3156 446379029 446382185 0.000000e+00 5219
10 TraesCS3A01G368300 chr1A 96.182 2960 108 4 1 2956 548066463 548069421 0.000000e+00 4835
11 TraesCS3A01G368300 chr1A 95.952 2396 78 7 1 2394 548047945 548050323 0.000000e+00 3869
12 TraesCS3A01G368300 chr1A 91.931 1735 88 23 1 1684 118198358 118196625 0.000000e+00 2381
13 TraesCS3A01G368300 chr1A 96.752 1139 35 1 1258 2394 548053303 548054441 0.000000e+00 1897
14 TraesCS3A01G368300 chr1A 95.780 1019 38 4 1 1015 548052294 548053311 0.000000e+00 1639
15 TraesCS3A01G368300 chr1A 98.049 205 4 0 2952 3156 548069448 548069652 1.080000e-94 357
16 TraesCS3A01G368300 chr7A 92.157 1734 85 16 1 1684 499950695 499952427 0.000000e+00 2401
17 TraesCS3A01G368300 chr7A 94.700 1283 66 2 1676 2956 93312659 93313941 0.000000e+00 1991
18 TraesCS3A01G368300 chr7A 95.122 205 10 0 2952 3156 93313968 93314172 1.090000e-84 324
19 TraesCS3A01G368300 chr7A 94.634 205 11 0 2952 3156 499953811 499954015 5.080000e-83 318
20 TraesCS3A01G368300 chr5A 91.988 1735 84 16 1 1683 689846395 689844664 0.000000e+00 2383
21 TraesCS3A01G368300 chr5A 94.384 1282 70 2 1676 2956 689844587 689843307 0.000000e+00 1967
22 TraesCS3A01G368300 chr6D 92.647 1632 84 8 1 1597 437005250 437006880 0.000000e+00 2316
23 TraesCS3A01G368300 chr6A 91.207 1740 96 19 1 1684 496416383 496418121 0.000000e+00 2313
24 TraesCS3A01G368300 chr6A 93.250 1526 78 8 1 1502 616507662 616506138 0.000000e+00 2224
25 TraesCS3A01G368300 chr6A 94.466 1283 67 3 1676 2956 616499223 616497943 0.000000e+00 1973
26 TraesCS3A01G368300 chr6A 95.122 205 10 0 2952 3156 594025994 594026198 1.090000e-84 324
27 TraesCS3A01G368300 chr6A 94.634 205 11 0 2952 3156 616497916 616497712 5.080000e-83 318
28 TraesCS3A01G368300 chr7D 91.958 1629 97 12 1 1595 610300187 610301815 0.000000e+00 2252
29 TraesCS3A01G368300 chr1D 90.103 1748 105 19 1 1685 70435830 70434088 0.000000e+00 2207
30 TraesCS3A01G368300 chr5D 88.779 1007 84 12 705 1684 318512015 318513019 0.000000e+00 1206


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G368300 chr3A 617226854 617230009 3155 True 5829.000000 5829 100.000000 1 3156 1 chr3A.!!$R1 3155
1 TraesCS3A01G368300 chr3A 617268791 617271932 3141 True 5393.000000 5393 97.591000 2 3156 1 chr3A.!!$R2 3154
2 TraesCS3A01G368300 chr3A 62482095 62483812 1717 False 2294.000000 2294 91.207000 1 1685 1 chr3A.!!$F1 1684
3 TraesCS3A01G368300 chr3A 535604949 535606460 1511 False 1150.000000 1980 94.809000 1676 3154 2 chr3A.!!$F2 1478
4 TraesCS3A01G368300 chr2A 728981167 728984322 3155 False 5240.000000 5240 96.647000 2 3156 1 chr2A.!!$F1 3154
5 TraesCS3A01G368300 chr2A 697151027 697154115 3088 False 2180.000000 2348 94.053500 1 2956 2 chr2A.!!$F2 2955
6 TraesCS3A01G368300 chr1A 446379029 446382185 3156 False 5219.000000 5219 96.516000 1 3156 1 chr1A.!!$F1 3155
7 TraesCS3A01G368300 chr1A 548066463 548069652 3189 False 2596.000000 4835 97.115500 1 3156 2 chr1A.!!$F3 3155
8 TraesCS3A01G368300 chr1A 548047945 548054441 6496 False 2468.333333 3869 96.161333 1 2394 3 chr1A.!!$F2 2393
9 TraesCS3A01G368300 chr1A 118196625 118198358 1733 True 2381.000000 2381 91.931000 1 1684 1 chr1A.!!$R1 1683
10 TraesCS3A01G368300 chr7A 499950695 499954015 3320 False 1359.500000 2401 93.395500 1 3156 2 chr7A.!!$F2 3155
11 TraesCS3A01G368300 chr7A 93312659 93314172 1513 False 1157.500000 1991 94.911000 1676 3156 2 chr7A.!!$F1 1480
12 TraesCS3A01G368300 chr5A 689843307 689846395 3088 True 2175.000000 2383 93.186000 1 2956 2 chr5A.!!$R1 2955
13 TraesCS3A01G368300 chr6D 437005250 437006880 1630 False 2316.000000 2316 92.647000 1 1597 1 chr6D.!!$F1 1596
14 TraesCS3A01G368300 chr6A 496416383 496418121 1738 False 2313.000000 2313 91.207000 1 1684 1 chr6A.!!$F1 1683
15 TraesCS3A01G368300 chr6A 616506138 616507662 1524 True 2224.000000 2224 93.250000 1 1502 1 chr6A.!!$R1 1501
16 TraesCS3A01G368300 chr6A 616497712 616499223 1511 True 1145.500000 1973 94.550000 1676 3156 2 chr6A.!!$R2 1480
17 TraesCS3A01G368300 chr7D 610300187 610301815 1628 False 2252.000000 2252 91.958000 1 1595 1 chr7D.!!$F1 1594
18 TraesCS3A01G368300 chr1D 70434088 70435830 1742 True 2207.000000 2207 90.103000 1 1685 1 chr1D.!!$R1 1684
19 TraesCS3A01G368300 chr5D 318512015 318513019 1004 False 1206.000000 1206 88.779000 705 1684 1 chr5D.!!$F1 979

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
68 74 0.250553 TTTTTGTGATCTCCGCCGGT 60.251 50.000 1.63 0.0 0.00 5.28 F
617 666 2.307929 CATCGGTGCGAATAGTACTCG 58.692 52.381 0.00 0.0 39.99 4.18 F
1141 1190 1.247567 CATCCACGGCAAGGAAAAGT 58.752 50.000 0.00 0.0 38.93 2.66 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1115 1164 0.888736 CTTGCCGTGGATGTCAACCA 60.889 55.000 0.0 0.0 34.84 3.67 R
1745 2018 1.276421 CTCCTTCAGGAACGGACACAT 59.724 52.381 0.0 0.0 44.91 3.21 R
2621 3063 1.071071 CACTTCCAAACCGTGACCCTA 59.929 52.381 0.0 0.0 0.00 3.53 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
44 45 3.254060 CATCGGTCGATTCTGTCTGTTT 58.746 45.455 2.84 0.00 31.62 2.83
68 74 0.250553 TTTTTGTGATCTCCGCCGGT 60.251 50.000 1.63 0.00 0.00 5.28
245 261 5.485353 TGAACCTATGAGGAGATCTTGTGTT 59.515 40.000 0.00 0.00 37.67 3.32
617 666 2.307929 CATCGGTGCGAATAGTACTCG 58.692 52.381 0.00 0.00 39.99 4.18
1115 1164 2.172717 ACTACAAAGTGCACCTCAAGGT 59.827 45.455 14.63 6.34 41.48 3.50
1141 1190 1.247567 CATCCACGGCAAGGAAAAGT 58.752 50.000 0.00 0.00 38.93 2.66
1745 2018 4.355720 CCTGCAGGCCCAAGAGCA 62.356 66.667 22.33 1.22 35.43 4.26
1748 2021 2.362120 GCAGGCCCAAGAGCATGT 60.362 61.111 0.00 0.00 45.95 3.21
2230 2504 7.252612 TGTCCTTTCTATTGTATCAGGTTCA 57.747 36.000 0.00 0.00 0.00 3.18
2621 3063 7.231722 AGAGTTGAGCTCCGAATACATAGTTAT 59.768 37.037 12.15 0.00 45.21 1.89
2796 4028 3.904339 ACAATAGTGTGGTCTGAGAGGTT 59.096 43.478 0.00 0.00 36.31 3.50
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
68 74 2.297701 GAAGCAAGGACTTCAACACCA 58.702 47.619 0.00 0.0 44.50 4.17
245 261 6.567701 GCAAAATCTCGAAACATTCCACACTA 60.568 38.462 0.00 0.0 0.00 2.74
539 566 6.586844 GCTCGTAACTCTAAAGACTTCACAAT 59.413 38.462 0.00 0.0 0.00 2.71
617 666 2.168728 GGACCCACAACAGATACTCTCC 59.831 54.545 0.00 0.0 0.00 3.71
1115 1164 0.888736 CTTGCCGTGGATGTCAACCA 60.889 55.000 0.00 0.0 34.84 3.67
1141 1190 2.011548 GCTGGTGCATACGACATCCAA 61.012 52.381 0.00 0.0 39.41 3.53
1568 1617 6.314400 ACACTAGAAGAGAAAGTACGCTAGAG 59.686 42.308 0.00 0.0 0.00 2.43
1745 2018 1.276421 CTCCTTCAGGAACGGACACAT 59.724 52.381 0.00 0.0 44.91 3.21
1934 2207 5.044919 TCTGTTTGTAGAATGGGTGGATCAT 60.045 40.000 0.00 0.0 0.00 2.45
2012 2286 6.405731 GCATACTCAATGAGGTAATTTGGCAA 60.406 38.462 15.38 0.0 37.86 4.52
2360 2634 6.643770 ACTTCAAAATCACATGATTGCTGAAC 59.356 34.615 19.09 0.0 43.41 3.18
2425 2701 1.668419 ACTCAGCGCAAAAAGACTGT 58.332 45.000 11.47 0.0 0.00 3.55
2621 3063 1.071071 CACTTCCAAACCGTGACCCTA 59.929 52.381 0.00 0.0 0.00 3.53
2754 3986 2.819608 GTGCACCCACAACATTGATACT 59.180 45.455 5.22 0.0 41.67 2.12
2796 4028 1.686355 AACCGAGCATTCCAACACAA 58.314 45.000 0.00 0.0 0.00 3.33


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.