Multiple sequence alignment - TraesCS3A01G366900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G366900 chr3A 100.000 2306 0 0 1 2306 615940612 615938307 0.000000e+00 4259
1 TraesCS3A01G366900 chr3D 93.364 2381 66 35 1 2305 473484355 473481991 0.000000e+00 3437
2 TraesCS3A01G366900 chr3B 92.978 2364 96 33 1 2305 629193122 629195474 0.000000e+00 3382
3 TraesCS3A01G366900 chr1D 76.809 1893 302 96 166 2014 375991523 375989724 0.000000e+00 937
4 TraesCS3A01G366900 chr1A 76.427 1892 295 97 166 2010 474793437 474791650 0.000000e+00 883
5 TraesCS3A01G366900 chr1A 74.714 1400 262 61 286 1644 59210327 59211675 7.250000e-150 540
6 TraesCS3A01G366900 chr1B 76.126 1910 318 94 166 2014 502219831 502217999 0.000000e+00 874
7 TraesCS3A01G366900 chr5D 74.935 1528 273 70 166 1647 42726853 42725390 1.180000e-167 599
8 TraesCS3A01G366900 chr5D 74.623 1525 268 75 166 1647 249913547 249912099 1.550000e-156 562
9 TraesCS3A01G366900 chr2D 74.052 1530 272 69 166 1647 185367261 185365809 5.680000e-141 510


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G366900 chr3A 615938307 615940612 2305 True 4259 4259 100.000 1 2306 1 chr3A.!!$R1 2305
1 TraesCS3A01G366900 chr3D 473481991 473484355 2364 True 3437 3437 93.364 1 2305 1 chr3D.!!$R1 2304
2 TraesCS3A01G366900 chr3B 629193122 629195474 2352 False 3382 3382 92.978 1 2305 1 chr3B.!!$F1 2304
3 TraesCS3A01G366900 chr1D 375989724 375991523 1799 True 937 937 76.809 166 2014 1 chr1D.!!$R1 1848
4 TraesCS3A01G366900 chr1A 474791650 474793437 1787 True 883 883 76.427 166 2010 1 chr1A.!!$R1 1844
5 TraesCS3A01G366900 chr1A 59210327 59211675 1348 False 540 540 74.714 286 1644 1 chr1A.!!$F1 1358
6 TraesCS3A01G366900 chr1B 502217999 502219831 1832 True 874 874 76.126 166 2014 1 chr1B.!!$R1 1848
7 TraesCS3A01G366900 chr5D 42725390 42726853 1463 True 599 599 74.935 166 1647 1 chr5D.!!$R1 1481
8 TraesCS3A01G366900 chr5D 249912099 249913547 1448 True 562 562 74.623 166 1647 1 chr5D.!!$R2 1481
9 TraesCS3A01G366900 chr2D 185365809 185367261 1452 True 510 510 74.052 166 1647 1 chr2D.!!$R1 1481

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1038 1175 4.224274 AAACGCGGGTCGGTGTCA 62.224 61.111 12.47 0.0 43.86 3.58 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2153 2344 1.276705 ACTTTCGCTTTCCTCTCTCCC 59.723 52.381 0.0 0.0 0.0 4.3 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1038 1175 4.224274 AAACGCGGGTCGGTGTCA 62.224 61.111 12.47 0.0 43.86 3.58
1842 2019 4.873129 CGGATGGCGGACGTGGAG 62.873 72.222 0.00 0.0 0.00 3.86
1929 2106 2.617274 GGTGCAGAAGCCGGTGAAC 61.617 63.158 1.90 0.0 41.13 3.18
2062 2253 4.664677 ACGTCACCTCACAGCGCC 62.665 66.667 2.29 0.0 0.00 6.53
2071 2262 4.025401 CACAGCGCCCCAACGTTC 62.025 66.667 2.29 0.0 34.88 3.95
2100 2291 1.904032 CTCTGGTTCTGGGAGGAGC 59.096 63.158 0.00 0.0 0.00 4.70
2102 2293 3.003173 TGGTTCTGGGAGGAGCGG 61.003 66.667 0.00 0.0 0.00 5.52
2149 2340 1.504900 CGGTTTTTAGAAGGGGCGC 59.495 57.895 0.00 0.0 0.00 6.53
2152 2343 0.956902 GTTTTTAGAAGGGGCGCGGA 60.957 55.000 8.83 0.0 0.00 5.54
2153 2344 0.675522 TTTTTAGAAGGGGCGCGGAG 60.676 55.000 8.83 0.0 0.00 4.63
2154 2345 2.530958 TTTTAGAAGGGGCGCGGAGG 62.531 60.000 8.83 0.0 0.00 4.30
2230 2433 1.299541 CGCTCTCACCTCTCTCTCTC 58.700 60.000 0.00 0.0 0.00 3.20
2297 2500 0.591170 GGCTCGCTTGTTGCTTTGTA 59.409 50.000 0.00 0.0 40.11 2.41
2300 2503 2.350772 GCTCGCTTGTTGCTTTGTATGT 60.351 45.455 0.00 0.0 40.11 2.29
2305 2508 2.967459 TGTTGCTTTGTATGTGCTCG 57.033 45.000 0.00 0.0 0.00 5.03
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
26 28 1.142474 GTACTGAACCAACGAACCCG 58.858 55.000 0.00 0.0 42.50 5.28
33 35 0.034337 TCCGCCTGTACTGAACCAAC 59.966 55.000 0.60 0.0 0.00 3.77
2149 2340 1.819905 GCTTTCCTCTCTCCCTCCG 59.180 63.158 0.00 0.0 0.00 4.63
2152 2343 1.552792 CTTTCGCTTTCCTCTCTCCCT 59.447 52.381 0.00 0.0 0.00 4.20
2153 2344 1.276705 ACTTTCGCTTTCCTCTCTCCC 59.723 52.381 0.00 0.0 0.00 4.30
2154 2345 2.753055 ACTTTCGCTTTCCTCTCTCC 57.247 50.000 0.00 0.0 0.00 3.71
2155 2346 5.120986 CCTTTAACTTTCGCTTTCCTCTCTC 59.879 44.000 0.00 0.0 0.00 3.20
2156 2347 4.998033 CCTTTAACTTTCGCTTTCCTCTCT 59.002 41.667 0.00 0.0 0.00 3.10
2218 2409 4.228824 ACTATAGACGGAGAGAGAGAGGT 58.771 47.826 6.78 0.0 0.00 3.85
2230 2433 5.673818 GCAAAGCAAAAGGAACTATAGACGG 60.674 44.000 6.78 0.0 38.49 4.79


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.