Multiple sequence alignment - TraesCS3A01G345900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G345900 chr3A 100.000 3018 0 0 1 3018 595106089 595109106 0.000000e+00 5574.0
1 TraesCS3A01G345900 chr3A 95.502 3046 99 30 1 3018 717937051 717934016 0.000000e+00 4831.0
2 TraesCS3A01G345900 chr1A 97.491 3029 49 9 1 3018 23399564 23402576 0.000000e+00 5147.0
3 TraesCS3A01G345900 chr1A 97.981 2873 45 4 1 2863 498220564 498217695 0.000000e+00 4972.0
4 TraesCS3A01G345900 chr1A 94.643 224 10 2 2796 3018 498217727 498217505 2.230000e-91 346.0
5 TraesCS3A01G345900 chr1A 95.745 47 2 0 2661 2707 23402259 23402305 3.230000e-10 76.8
6 TraesCS3A01G345900 chr1A 95.745 47 2 0 2661 2707 498217856 498217810 3.230000e-10 76.8
7 TraesCS3A01G345900 chr5A 97.286 3021 51 15 1 3018 99544902 99541910 0.000000e+00 5096.0
8 TraesCS3A01G345900 chr5A 97.313 2866 58 14 1 2863 522122677 522119828 0.000000e+00 4848.0
9 TraesCS3A01G345900 chr5A 96.507 2863 81 12 1 2860 59605837 59608683 0.000000e+00 4715.0
10 TraesCS3A01G345900 chr5A 84.211 228 31 1 2796 3018 563097993 563097766 1.820000e-52 217.0
11 TraesCS3A01G345900 chr2A 98.254 2863 47 3 1 2860 202056341 202059203 0.000000e+00 5007.0
12 TraesCS3A01G345900 chr2A 92.070 227 16 2 2793 3018 202059171 202059396 4.860000e-83 318.0
13 TraesCS3A01G345900 chr6A 98.148 2862 51 2 1 2860 559145208 559148069 0.000000e+00 4990.0
14 TraesCS3A01G345900 chr6A 97.171 2863 62 14 1 2860 37847013 37849859 0.000000e+00 4820.0
15 TraesCS3A01G345900 chr6A 96.654 2869 74 15 1 2863 590129457 590126605 0.000000e+00 4747.0
16 TraesCS3A01G345900 chr6A 96.787 1805 40 13 1057 2860 585129947 585131734 0.000000e+00 2996.0
17 TraesCS3A01G345900 chr6A 94.273 227 11 2 2793 3018 559148037 559148262 2.230000e-91 346.0
18 TraesCS3A01G345900 chr6A 84.211 228 31 1 2796 3018 592294746 592294973 1.820000e-52 217.0
19 TraesCS3A01G345900 chr4A 97.834 2862 60 2 1 2860 362824480 362827341 0.000000e+00 4940.0
20 TraesCS3A01G345900 chr4A 93.833 227 12 2 2793 3018 362827309 362827534 1.040000e-89 340.0
21 TraesCS3A01G345900 chr7A 96.751 2093 51 12 772 2863 35613419 35611343 0.000000e+00 3472.0
22 TraesCS3A01G345900 chr7A 98.113 159 3 0 2860 3018 35611204 35611046 8.240000e-71 278.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G345900 chr3A 595106089 595109106 3017 False 5574.000000 5574 100.0000 1 3018 1 chr3A.!!$F1 3017
1 TraesCS3A01G345900 chr3A 717934016 717937051 3035 True 4831.000000 4831 95.5020 1 3018 1 chr3A.!!$R1 3017
2 TraesCS3A01G345900 chr1A 23399564 23402576 3012 False 2611.900000 5147 96.6180 1 3018 2 chr1A.!!$F1 3017
3 TraesCS3A01G345900 chr1A 498217505 498220564 3059 True 1798.266667 4972 96.1230 1 3018 3 chr1A.!!$R1 3017
4 TraesCS3A01G345900 chr5A 99541910 99544902 2992 True 5096.000000 5096 97.2860 1 3018 1 chr5A.!!$R1 3017
5 TraesCS3A01G345900 chr5A 522119828 522122677 2849 True 4848.000000 4848 97.3130 1 2863 1 chr5A.!!$R2 2862
6 TraesCS3A01G345900 chr5A 59605837 59608683 2846 False 4715.000000 4715 96.5070 1 2860 1 chr5A.!!$F1 2859
7 TraesCS3A01G345900 chr2A 202056341 202059396 3055 False 2662.500000 5007 95.1620 1 3018 2 chr2A.!!$F1 3017
8 TraesCS3A01G345900 chr6A 37847013 37849859 2846 False 4820.000000 4820 97.1710 1 2860 1 chr6A.!!$F1 2859
9 TraesCS3A01G345900 chr6A 590126605 590129457 2852 True 4747.000000 4747 96.6540 1 2863 1 chr6A.!!$R1 2862
10 TraesCS3A01G345900 chr6A 585129947 585131734 1787 False 2996.000000 2996 96.7870 1057 2860 1 chr6A.!!$F2 1803
11 TraesCS3A01G345900 chr6A 559145208 559148262 3054 False 2668.000000 4990 96.2105 1 3018 2 chr6A.!!$F4 3017
12 TraesCS3A01G345900 chr4A 362824480 362827534 3054 False 2640.000000 4940 95.8335 1 3018 2 chr4A.!!$F1 3017
13 TraesCS3A01G345900 chr7A 35611046 35613419 2373 True 1875.000000 3472 97.4320 772 3018 2 chr7A.!!$R1 2246

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
346 349 0.110678 ATCGACGGGATGCCTCTCTA 59.889 55.0 0.28 0.0 32.92 2.43 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2146 2153 0.398522 ACCGCACCCTCATCATCCTA 60.399 55.0 0.0 0.0 0.0 2.94 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
64 65 8.736244 GCCCTAAGATTTGTCATTACTTGTTTA 58.264 33.333 0.00 0.0 0.00 2.01
228 229 3.991051 CGCTCCACTGGTGTCCGT 61.991 66.667 0.00 0.0 0.00 4.69
293 295 1.115467 GACTGGGAGATGACCGTGAT 58.885 55.000 0.00 0.0 0.00 3.06
346 349 0.110678 ATCGACGGGATGCCTCTCTA 59.889 55.000 0.28 0.0 32.92 2.43
484 487 1.308069 GCATCCGGAGCTGCTTTCAA 61.308 55.000 20.45 0.0 35.49 2.69
975 981 4.398319 CTTACAAGTGGGATGTGGTTTCT 58.602 43.478 0.00 0.0 32.27 2.52
1293 1300 0.454620 ATCGCGTGTCTCGTCAGTTC 60.455 55.000 5.77 0.0 42.13 3.01
1444 1451 0.110486 GGTTGGACAGGAGAAGGCAA 59.890 55.000 0.00 0.0 0.00 4.52
1447 1454 1.118965 TGGACAGGAGAAGGCAACGA 61.119 55.000 0.00 0.0 46.39 3.85
1503 1510 1.348366 TGTTACCCGCTTCCAGCTTTA 59.652 47.619 0.00 0.0 39.60 1.85
1618 1625 0.394565 GAGTTGAGATATGCCCGCCT 59.605 55.000 0.00 0.0 0.00 5.52
1909 1916 3.396946 AGGCAATGATGATGGTCCACTAT 59.603 43.478 0.00 0.0 0.00 2.12
1972 1979 3.326747 AGTCTATGTTGCGGAGTTTCAC 58.673 45.455 0.00 0.0 0.00 3.18
2006 2013 3.792401 TGTTCATGTTATAGCGTCAGGG 58.208 45.455 0.00 0.0 0.00 4.45
2146 2153 6.648310 CGATGTGAGTTCCTCATATGCTTATT 59.352 38.462 8.02 0.0 41.22 1.40
2473 2508 1.306141 AGGAGGCTCGTCCATCCAA 60.306 57.895 8.69 0.0 39.34 3.53
2864 3062 0.744874 CTAGGCGCTGCACCTTACTA 59.255 55.000 15.28 0.0 38.81 1.82
2897 3095 4.581824 AGTTGACAGCACATTCATTTCACT 59.418 37.500 0.00 0.0 0.00 3.41
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
64 65 3.638160 TCAAAGGTTCAAGCTTCTGCAAT 59.362 39.130 1.45 0.0 42.74 3.56
228 229 0.250234 CCTCCACCGATCAGCAAGAA 59.750 55.000 0.00 0.0 0.00 2.52
261 262 1.555075 TCCCAGTCCGAAGATGGAAAG 59.445 52.381 0.00 0.0 40.44 2.62
346 349 3.307269 CCCATCAGAATCGGTGCTCATAT 60.307 47.826 0.00 0.0 0.00 1.78
385 388 2.353208 GGAGCCATACCGATAAGAGCAG 60.353 54.545 0.00 0.0 0.00 4.24
975 981 3.569250 TTGACATCGTTCGTCATCTCA 57.431 42.857 5.42 0.0 42.69 3.27
1150 1157 1.549170 GTACCCAAGTCTGTCATCGGT 59.451 52.381 0.00 0.0 0.00 4.69
1444 1451 3.581332 TGTCCCAGTCCTTTATCTTTCGT 59.419 43.478 0.00 0.0 0.00 3.85
1447 1454 4.202567 TGCTTGTCCCAGTCCTTTATCTTT 60.203 41.667 0.00 0.0 0.00 2.52
1503 1510 0.461961 GCTACGAGCTTCCTCCACAT 59.538 55.000 0.00 0.0 38.45 3.21
1909 1916 4.365514 TTTGTACCTTGAGGAATGCTCA 57.634 40.909 0.00 0.0 38.94 4.26
1972 1979 5.443185 AACATGAACAAGTGTGGAAGATG 57.557 39.130 0.00 0.0 0.00 2.90
2006 2013 2.103537 TAACCGCCTTAACTTCCTGC 57.896 50.000 0.00 0.0 0.00 4.85
2146 2153 0.398522 ACCGCACCCTCATCATCCTA 60.399 55.000 0.00 0.0 0.00 2.94
2473 2508 3.345414 CTGCAGGCAATCTTCTTCTTCT 58.655 45.455 5.57 0.0 0.00 2.85
2864 3062 3.505680 TGTGCTGTCAACTCTGTTTTTGT 59.494 39.130 0.00 0.0 0.00 2.83


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.