Multiple sequence alignment - TraesCS3A01G345600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G345600 chr3A 100.000 2141 0 0 1 2141 594899383 594897243 0 3954
1 TraesCS3A01G345600 chr3A 98.319 2142 33 3 1 2141 672909766 672907627 0 3753
2 TraesCS3A01G345600 chr5D 98.693 2142 27 1 1 2141 503218459 503220600 0 3799
3 TraesCS3A01G345600 chr5D 98.366 2142 34 1 1 2141 503277985 503275844 0 3760
4 TraesCS3A01G345600 chr1A 98.693 2142 27 1 1 2141 554512489 554514630 0 3799
5 TraesCS3A01G345600 chr3B 98.506 2142 31 1 1 2141 201527265 201529406 0 3777
6 TraesCS3A01G345600 chr3D 98.459 2142 29 3 1 2141 589279301 589277163 0 3770


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G345600 chr3A 594897243 594899383 2140 True 3954 3954 100.000 1 2141 1 chr3A.!!$R1 2140
1 TraesCS3A01G345600 chr3A 672907627 672909766 2139 True 3753 3753 98.319 1 2141 1 chr3A.!!$R2 2140
2 TraesCS3A01G345600 chr5D 503218459 503220600 2141 False 3799 3799 98.693 1 2141 1 chr5D.!!$F1 2140
3 TraesCS3A01G345600 chr5D 503275844 503277985 2141 True 3760 3760 98.366 1 2141 1 chr5D.!!$R1 2140
4 TraesCS3A01G345600 chr1A 554512489 554514630 2141 False 3799 3799 98.693 1 2141 1 chr1A.!!$F1 2140
5 TraesCS3A01G345600 chr3B 201527265 201529406 2141 False 3777 3777 98.506 1 2141 1 chr3B.!!$F1 2140
6 TraesCS3A01G345600 chr3D 589277163 589279301 2138 True 3770 3770 98.459 1 2141 1 chr3D.!!$R1 2140

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
243 244 0.695803 CCTCCCCCTCTATGCCTTGT 60.696 60.0 0.0 0.0 0.0 3.16 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1974 1977 1.003839 ACCAAAGATCTTGCGCGGA 60.004 52.632 9.17 0.0 0.0 5.54 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
150 151 5.120399 TGCATTTCGATTAGGGTCGTATTT 58.880 37.500 0.00 0.00 42.07 1.40
243 244 0.695803 CCTCCCCCTCTATGCCTTGT 60.696 60.000 0.00 0.00 0.00 3.16
336 337 4.574674 TGGATTTCACTTGCCTGTCTAT 57.425 40.909 0.00 0.00 0.00 1.98
474 475 5.201713 AGGGTAATGATCATACGTCTGTG 57.798 43.478 9.04 0.00 0.00 3.66
521 522 6.504279 AGGTCCTATTCTTCTACCTTTTCCAA 59.496 38.462 0.00 0.00 37.25 3.53
605 606 7.336931 GCTTTATTTCTGTCTTAGTGAATCCCA 59.663 37.037 0.00 0.00 0.00 4.37
614 615 5.642063 GTCTTAGTGAATCCCAATTCGACAA 59.358 40.000 0.00 0.00 43.61 3.18
616 617 6.884295 TCTTAGTGAATCCCAATTCGACAATT 59.116 34.615 0.00 0.00 43.61 2.32
709 710 6.239600 CCATAAATCGACTTTCCCTCCTATGA 60.240 42.308 0.00 0.00 0.00 2.15
811 812 8.890718 GTTATGTATGGATGATGGATGAGATTG 58.109 37.037 0.00 0.00 0.00 2.67
812 813 6.691255 TGTATGGATGATGGATGAGATTGA 57.309 37.500 0.00 0.00 0.00 2.57
1343 1344 5.640147 ACAATCACTTATTCCCAAACCTCA 58.360 37.500 0.00 0.00 0.00 3.86
1639 1641 3.701542 TCCAGTGCACTAGATCTTGTAGG 59.298 47.826 21.20 12.49 0.00 3.18
1940 1943 3.733224 CGAGCATGAAGAGATTAACGAGG 59.267 47.826 0.00 0.00 0.00 4.63
1974 1977 1.133915 TGAGTTTTTCTGGCGGACCTT 60.134 47.619 0.00 0.00 36.63 3.50
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
24 25 6.445357 TTGTTTCTGGTACAAAAGTTCCTC 57.555 37.500 0.00 0.0 38.70 3.71
150 151 9.085645 ACATATCTGGTAGAATCGTAACCATAA 57.914 33.333 5.80 0.1 42.23 1.90
474 475 1.985473 TCTGGGCCATACAATGCATC 58.015 50.000 6.72 0.0 0.00 3.91
521 522 3.243569 GCTGTGAATAGCCATCGACTACT 60.244 47.826 0.00 0.0 37.73 2.57
709 710 7.825331 TTCTTATCGATACTGGAACTCAGAT 57.175 36.000 4.16 0.0 46.18 2.90
811 812 3.389329 TGGAACTGGCTCTCTATCCATTC 59.611 47.826 0.00 0.0 32.28 2.67
812 813 3.387962 TGGAACTGGCTCTCTATCCATT 58.612 45.455 0.00 0.0 32.28 3.16
872 873 2.760634 AATTTGCGGGTTCAATTCCC 57.239 45.000 0.00 0.0 41.41 3.97
1343 1344 6.834168 AAATGAAAACGATTAGTCCCACAT 57.166 33.333 0.00 0.0 0.00 3.21
1639 1641 2.667473 TAGGGCTTCGTTGCTAAGTC 57.333 50.000 2.92 0.0 0.00 3.01
1940 1943 7.221645 CCAGAAAAACTCAAAAGAGAAAGAAGC 59.778 37.037 0.00 0.0 0.00 3.86
1974 1977 1.003839 ACCAAAGATCTTGCGCGGA 60.004 52.632 9.17 0.0 0.00 5.54


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.