Multiple sequence alignment - TraesCS3A01G345500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G345500 chr3A 100.000 2211 0 0 1 2211 594894745 594896955 0 4084
1 TraesCS3A01G345500 chr3A 98.056 2212 41 2 1 2211 672905130 672907340 0 3845
2 TraesCS3A01G345500 chr3A 97.742 2214 33 8 1 2211 164859179 164861378 0 3795
3 TraesCS3A01G345500 chr3A 98.628 1749 22 2 1 1748 66012739 66014486 0 3096
4 TraesCS3A01G345500 chr3B 98.423 2219 26 4 1 2211 101916062 101913845 0 3895
5 TraesCS3A01G345500 chrUn 98.373 2213 32 3 1 2211 216513723 216515933 0 3884
6 TraesCS3A01G345500 chrUn 98.373 2213 32 3 1 2211 286269660 286267450 0 3884
7 TraesCS3A01G345500 chr3D 98.328 2213 34 3 1 2211 589272074 589274285 0 3879
8 TraesCS3A01G345500 chr5D 98.284 2215 34 3 1 2211 503223102 503220888 0 3877
9 TraesCS3A01G345500 chr5D 97.967 2214 41 4 1 2211 6193822 6191610 0 3836
10 TraesCS3A01G345500 chr1D 97.964 2210 43 2 1 2208 254393230 254395439 0 3831


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G345500 chr3A 594894745 594896955 2210 False 4084 4084 100.000 1 2211 1 chr3A.!!$F3 2210
1 TraesCS3A01G345500 chr3A 672905130 672907340 2210 False 3845 3845 98.056 1 2211 1 chr3A.!!$F4 2210
2 TraesCS3A01G345500 chr3A 164859179 164861378 2199 False 3795 3795 97.742 1 2211 1 chr3A.!!$F2 2210
3 TraesCS3A01G345500 chr3A 66012739 66014486 1747 False 3096 3096 98.628 1 1748 1 chr3A.!!$F1 1747
4 TraesCS3A01G345500 chr3B 101913845 101916062 2217 True 3895 3895 98.423 1 2211 1 chr3B.!!$R1 2210
5 TraesCS3A01G345500 chrUn 216513723 216515933 2210 False 3884 3884 98.373 1 2211 1 chrUn.!!$F1 2210
6 TraesCS3A01G345500 chrUn 286267450 286269660 2210 True 3884 3884 98.373 1 2211 1 chrUn.!!$R1 2210
7 TraesCS3A01G345500 chr3D 589272074 589274285 2211 False 3879 3879 98.328 1 2211 1 chr3D.!!$F1 2210
8 TraesCS3A01G345500 chr5D 503220888 503223102 2214 True 3877 3877 98.284 1 2211 1 chr5D.!!$R2 2210
9 TraesCS3A01G345500 chr5D 6191610 6193822 2212 True 3836 3836 97.967 1 2211 1 chr5D.!!$R1 2210
10 TraesCS3A01G345500 chr1D 254393230 254395439 2209 False 3831 3831 97.964 1 2208 1 chr1D.!!$F1 2207

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
777 779 1.362224 ATGGGCGCTAGGGTTATGAT 58.638 50.0 7.64 0.0 0.0 2.45 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2099 2111 0.479815 ACCCGATCCGATAGTACCCA 59.52 55.0 0.0 0.0 0.0 4.51 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
89 90 3.394606 TGGGGAATCTCCTTGCTATTACC 59.605 47.826 0.00 0.00 36.57 2.85
138 139 3.576078 ATTCGTCCATAGGGCAAATCA 57.424 42.857 0.00 0.00 0.00 2.57
457 459 7.510675 TCTTGGTTTCAATAGGACTCCTTAT 57.489 36.000 1.94 0.00 34.61 1.73
678 680 4.362677 TCAGGATACCCTCTTTTAGCTGT 58.637 43.478 0.00 0.00 42.02 4.40
714 716 9.716556 TTCTTAGTTCAAGATCCCTCTTACTAT 57.283 33.333 0.00 0.00 42.88 2.12
777 779 1.362224 ATGGGCGCTAGGGTTATGAT 58.638 50.000 7.64 0.00 0.00 2.45
1018 1020 3.554934 CATATGCACCTCTTTGGGCTTA 58.445 45.455 0.00 0.00 41.11 3.09
1272 1274 4.632327 TGATGGTGAAATGGTAGACACA 57.368 40.909 0.00 0.00 35.33 3.72
1410 1412 2.106684 TGGCGCTCTCCTCTATCTTCTA 59.893 50.000 7.64 0.00 0.00 2.10
1702 1707 2.177394 TTGTATCCTTTGAGCGCACA 57.823 45.000 11.47 6.87 0.00 4.57
2147 2159 3.432378 AGAATAGACAGAGGTCCGTTGT 58.568 45.455 1.44 1.44 45.48 3.32
2152 2165 4.618920 AGACAGAGGTCCGTTGTATTTT 57.381 40.909 1.81 0.00 45.48 1.82
2157 2170 3.262405 AGAGGTCCGTTGTATTTTAGCCA 59.738 43.478 0.00 0.00 0.00 4.75
2182 2195 1.295292 TCTCCTTTCAGGGCCTATCCT 59.705 52.381 5.28 0.00 35.59 3.24
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
89 90 3.364621 GCATACGTTTCATGCTTGTTTGG 59.635 43.478 13.32 0.00 44.35 3.28
513 515 7.013834 ACATAAGGGGTTATTTCTTGGTTTCA 58.986 34.615 0.00 0.00 0.00 2.69
633 635 3.806507 GCAATTGCAAGAATGGGGTTCAA 60.807 43.478 25.36 0.00 39.00 2.69
777 779 7.448748 TCGAGTCGATTCCATGATTATAAGA 57.551 36.000 12.09 0.00 0.00 2.10
1410 1412 7.552612 TCTCAGGGAGATGGTTAAGGACCTT 62.553 48.000 12.41 12.41 40.38 3.50
1702 1707 7.147846 CCTTGATTTGATTGCTACTTAATGGGT 60.148 37.037 0.00 0.00 0.00 4.51
2099 2111 0.479815 ACCCGATCCGATAGTACCCA 59.520 55.000 0.00 0.00 0.00 4.51
2147 2159 8.511604 CTGAAAGGAGAAGAATGGCTAAAATA 57.488 34.615 0.00 0.00 0.00 1.40
2182 2195 6.546428 CCAAGAGGTACTGGATTCTCTTTA 57.454 41.667 6.98 0.00 42.56 1.85


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.