Multiple sequence alignment - TraesCS3A01G318000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G318000 chr3A 100.000 2849 0 0 1 2849 559263429 559266277 0.000000e+00 5262
1 TraesCS3A01G318000 chr3A 99.369 2851 16 1 1 2849 559333116 559335966 0.000000e+00 5164
2 TraesCS3A01G318000 chr3A 91.631 1386 98 8 667 2037 559064391 559065773 0.000000e+00 1901
3 TraesCS3A01G318000 chr3A 74.636 343 59 15 392 728 559335560 559335880 2.980000e-25 126
4 TraesCS3A01G318000 chr3B 90.830 2181 133 25 5 2136 556946178 556944016 0.000000e+00 2857
5 TraesCS3A01G318000 chr3B 92.857 1372 86 6 673 2037 556960603 556959237 0.000000e+00 1980
6 TraesCS3A01G318000 chr3B 92.152 790 44 4 1258 2037 556933738 556932957 0.000000e+00 1099
7 TraesCS3A01G318000 chr3B 88.696 920 73 5 1263 2152 556935530 556934612 0.000000e+00 1094
8 TraesCS3A01G318000 chr3B 93.333 615 37 3 662 1275 556939722 556939111 0.000000e+00 905
9 TraesCS3A01G318000 chr3B 86.637 449 31 8 1859 2307 556943265 556942846 1.190000e-128 470
10 TraesCS3A01G318000 chr3B 91.289 287 13 2 2306 2583 556940117 556939834 5.760000e-102 381
11 TraesCS3A01G318000 chr3B 86.787 333 34 8 6 330 556961237 556960907 2.090000e-96 363
12 TraesCS3A01G318000 chr3B 93.388 121 6 2 2644 2763 556945560 556945441 8.110000e-41 178
13 TraesCS3A01G318000 chr3B 84.848 132 18 2 2177 2307 295549500 295549630 6.400000e-27 132
14 TraesCS3A01G318000 chr3D 92.358 1374 94 5 673 2037 427295356 427293985 0.000000e+00 1945
15 TraesCS3A01G318000 chr3D 88.292 1657 139 31 519 2136 427285803 427284163 0.000000e+00 1934
16 TraesCS3A01G318000 chr3D 90.651 1444 114 12 599 2029 427234147 427232712 0.000000e+00 1899
17 TraesCS3A01G318000 chr3D 88.880 1259 103 17 952 2178 427289369 427288116 0.000000e+00 1515
18 TraesCS3A01G318000 chr3D 88.758 1192 108 12 985 2152 427280532 427279343 0.000000e+00 1435
19 TraesCS3A01G318000 chr3D 92.072 946 66 7 5 947 427290801 427289862 0.000000e+00 1323
20 TraesCS3A01G318000 chr3D 88.393 896 85 13 66 955 427281410 427280528 0.000000e+00 1061
21 TraesCS3A01G318000 chr3D 91.065 291 13 3 2340 2630 427286056 427285779 5.760000e-102 381
22 TraesCS3A01G318000 chr3D 91.304 115 8 2 2650 2763 427234136 427234023 3.800000e-34 156
23 TraesCS3A01G318000 chr3D 87.603 121 13 2 2644 2763 427280874 427280755 3.830000e-29 139
24 TraesCS3A01G318000 chr3D 90.722 97 6 2 2656 2752 427285705 427285612 2.980000e-25 126
25 TraesCS3A01G318000 chrUn 100.000 420 0 0 2251 2670 476920798 476921217 0.000000e+00 776
26 TraesCS3A01G318000 chr2A 87.705 122 14 1 2186 2307 631588240 631588360 1.060000e-29 141
27 TraesCS3A01G318000 chr7A 85.496 131 17 2 2178 2307 629597441 629597570 4.950000e-28 135
28 TraesCS3A01G318000 chr6B 85.496 131 17 2 2178 2307 349439474 349439345 4.950000e-28 135
29 TraesCS3A01G318000 chr4B 85.496 131 17 2 2178 2307 169830239 169830368 4.950000e-28 135
30 TraesCS3A01G318000 chr6D 84.848 132 20 0 2176 2307 131603202 131603071 1.780000e-27 134
31 TraesCS3A01G318000 chr7D 84.848 132 18 2 2177 2307 323762415 323762545 6.400000e-27 132
32 TraesCS3A01G318000 chr1A 84.444 135 18 3 2174 2307 330170453 330170321 2.300000e-26 130


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G318000 chr3A 559263429 559266277 2848 False 5262.000000 5262 100.000000 1 2849 1 chr3A.!!$F2 2848
1 TraesCS3A01G318000 chr3A 559333116 559335966 2850 False 2645.000000 5164 87.002500 1 2849 2 chr3A.!!$F3 2848
2 TraesCS3A01G318000 chr3A 559064391 559065773 1382 False 1901.000000 1901 91.631000 667 2037 1 chr3A.!!$F1 1370
3 TraesCS3A01G318000 chr3B 556959237 556961237 2000 True 1171.500000 1980 89.822000 6 2037 2 chr3B.!!$R2 2031
4 TraesCS3A01G318000 chr3B 556932957 556946178 13221 True 997.714286 2857 90.903571 5 2763 7 chr3B.!!$R1 2758
5 TraesCS3A01G318000 chr3D 427279343 427295356 16013 True 1095.444444 1945 89.793667 5 2763 9 chr3D.!!$R2 2758
6 TraesCS3A01G318000 chr3D 427232712 427234147 1435 True 1027.500000 1899 90.977500 599 2763 2 chr3D.!!$R1 2164

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
74 4633 6.832520 AAATGTACTTGCACATGATTACCA 57.167 33.333 0.00 0.0 39.10 3.25 F
1060 6180 1.259609 CTTTGCATTCAAGGCCTCCA 58.740 50.000 5.23 0.0 33.12 3.86 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1060 6180 1.66056 GCAGGCGTCCATTGAGCAAT 61.661 55.0 0.0 0.0 0.0 3.56 R
2122 17129 1.64571 AGTGGGAGGACGAAGATGTT 58.354 50.0 0.0 0.0 0.0 2.71 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
74 4633 6.832520 AAATGTACTTGCACATGATTACCA 57.167 33.333 0.00 0.00 39.10 3.25
1060 6180 1.259609 CTTTGCATTCAAGGCCTCCA 58.740 50.000 5.23 0.00 33.12 3.86
2063 17070 2.227194 CTGTTTAATATGGGGTCGCCC 58.773 52.381 3.03 6.38 44.51 6.13
2122 17129 3.848272 GATTGAAATCCAACGGCTTGA 57.152 42.857 0.00 0.00 37.63 3.02
2198 17205 5.644977 ATGTGACGTCTCAGAGTTAATCA 57.355 39.130 23.01 0.00 0.00 2.57
2670 21055 3.028130 TCGCAGTACAAGACATCCCATA 58.972 45.455 0.00 0.00 0.00 2.74
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
74 4633 4.022849 GCATGTCAGGCTAACAAAGTCTTT 60.023 41.667 1.35 0.00 38.42 2.52
1060 6180 1.660560 GCAGGCGTCCATTGAGCAAT 61.661 55.000 0.00 0.00 0.00 3.56
2063 17070 6.472163 AGTCAACTAAAATTCAAGCACAAACG 59.528 34.615 0.00 0.00 0.00 3.60
2122 17129 1.645710 AGTGGGAGGACGAAGATGTT 58.354 50.000 0.00 0.00 0.00 2.71
2179 17186 4.082245 TGCATGATTAACTCTGAGACGTCA 60.082 41.667 19.50 9.87 0.00 4.35
2246 17253 3.939592 AGTCGTGTCGTGATATCTTCTCA 59.060 43.478 3.98 0.00 0.00 3.27
2249 17256 4.539509 AGAGTCGTGTCGTGATATCTTC 57.460 45.455 3.98 0.00 0.00 2.87
2670 21055 5.525378 CACTGCTTTCAAGTTCTCTTAGTGT 59.475 40.000 0.00 0.00 32.57 3.55


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.