Multiple sequence alignment - TraesCS3A01G314600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G314600 chr3A 100.000 2951 0 0 882 3832 555662638 555659688 0.000000e+00 5450.0
1 TraesCS3A01G314600 chr3A 99.513 2465 12 0 882 3346 555695840 555693376 0.000000e+00 4486.0
2 TraesCS3A01G314600 chr3A 100.000 565 0 0 1 565 555663519 555662955 0.000000e+00 1044.0
3 TraesCS3A01G314600 chr3A 97.751 578 0 2 1 565 555697825 555697248 0.000000e+00 983.0
4 TraesCS3A01G314600 chr3A 98.102 527 9 1 3306 3832 555693163 555692638 0.000000e+00 917.0
5 TraesCS3A01G314600 chr3A 82.319 690 89 15 1969 2653 117806517 117807178 5.560000e-158 568.0
6 TraesCS3A01G314600 chr3A 82.319 690 89 15 1969 2653 117835417 117836078 5.560000e-158 568.0
7 TraesCS3A01G314600 chr3A 80.556 288 42 11 2646 2926 117807246 117807526 3.880000e-50 209.0
8 TraesCS3A01G314600 chr3A 80.208 288 43 11 2646 2926 117836146 117836426 1.800000e-48 204.0
9 TraesCS3A01G314600 chr3A 100.000 53 0 0 513 565 555696747 555696695 8.760000e-17 99.0
10 TraesCS3A01G314600 chr3D 92.378 2283 104 19 904 3126 100392980 100395252 0.000000e+00 3188.0
11 TraesCS3A01G314600 chr3D 83.357 691 80 17 1969 2653 100228351 100229012 1.180000e-169 606.0
12 TraesCS3A01G314600 chr3D 91.837 147 8 3 1 144 100391686 100391831 6.490000e-48 202.0
13 TraesCS3A01G314600 chr3D 88.235 68 5 1 498 565 100392162 100392226 1.140000e-10 78.7
14 TraesCS3A01G314600 chr3B 91.970 2279 105 22 904 3125 150853194 150855451 0.000000e+00 3123.0
15 TraesCS3A01G314600 chr3B 89.356 357 27 3 1 347 150852234 150852589 4.540000e-119 438.0
16 TraesCS3A01G314600 chr3B 87.500 152 17 2 3456 3606 150855598 150855748 1.420000e-39 174.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G314600 chr3A 555659688 555663519 3831 True 3247.000000 5450 100.000000 1 3832 2 chr3A.!!$R1 3831
1 TraesCS3A01G314600 chr3A 555692638 555697825 5187 True 1621.250000 4486 98.841500 1 3832 4 chr3A.!!$R2 3831
2 TraesCS3A01G314600 chr3A 117806517 117807526 1009 False 388.500000 568 81.437500 1969 2926 2 chr3A.!!$F1 957
3 TraesCS3A01G314600 chr3A 117835417 117836426 1009 False 386.000000 568 81.263500 1969 2926 2 chr3A.!!$F2 957
4 TraesCS3A01G314600 chr3D 100391686 100395252 3566 False 1156.233333 3188 90.816667 1 3126 3 chr3D.!!$F2 3125
5 TraesCS3A01G314600 chr3D 100228351 100229012 661 False 606.000000 606 83.357000 1969 2653 1 chr3D.!!$F1 684
6 TraesCS3A01G314600 chr3B 150852234 150855748 3514 False 1245.000000 3123 89.608667 1 3606 3 chr3B.!!$F1 3605

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1861 3387 2.886523 CCTGCTGTTGACATGGAAAGAA 59.113 45.455 0.0 0.0 0.0 2.52 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
3588 5478 1.493311 CGGCTCGCTCAAAGTCAAC 59.507 57.895 0.0 0.0 0.0 3.18 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1861 3387 2.886523 CCTGCTGTTGACATGGAAAGAA 59.113 45.455 0.0 0.0 0.0 2.52
2800 4405 2.347731 CTTTGGAAGTAGGAGCGGAAC 58.652 52.381 0.0 0.0 0.0 3.62
3019 4629 4.094442 CGGTTTGTTGGTAGAAAGATAGGC 59.906 45.833 0.0 0.0 0.0 3.93
3427 5316 3.189606 TGAAAGAAGCTATGAAGGGGGA 58.810 45.455 0.0 0.0 0.0 4.81
3433 5322 1.694696 AGCTATGAAGGGGGACGATTC 59.305 52.381 0.0 0.0 0.0 2.52
3588 5478 1.000283 AGAGACAAGAGGAGCACAACG 60.000 52.381 0.0 0.0 0.0 4.10
3631 5521 2.776312 TCTCGTCGAACATAGCATCC 57.224 50.000 0.0 0.0 0.0 3.51
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
522 697 8.994429 TCAAACGGTAAAATGAATGCAATAAT 57.006 26.923 0.00 0.00 0.00 1.28
523 698 8.818141 TTCAAACGGTAAAATGAATGCAATAA 57.182 26.923 0.00 0.00 0.00 1.40
524 699 8.994429 ATTCAAACGGTAAAATGAATGCAATA 57.006 26.923 0.00 0.00 40.11 1.90
1814 3340 2.424246 TGGTTTTCCGGTTTCTGTGAAC 59.576 45.455 0.00 0.00 44.36 3.18
1861 3387 3.706594 TCTGCCGATCTTGAACTCCTTAT 59.293 43.478 0.00 0.00 0.00 1.73
3019 4629 9.722056 CCAGATTTTTATATTCGGAAAACTCTG 57.278 33.333 15.32 15.32 44.15 3.35
3414 5303 1.694696 AGAATCGTCCCCCTTCATAGC 59.305 52.381 0.00 0.00 0.00 2.97
3433 5322 5.578727 CAGTTTTTCTGGACGATTCTCCTAG 59.421 44.000 0.00 0.00 40.23 3.02
3588 5478 1.493311 CGGCTCGCTCAAAGTCAAC 59.507 57.895 0.00 0.00 0.00 3.18


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.