Multiple sequence alignment - TraesCS3A01G311700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G311700 chr3A 100.000 3006 0 0 1 3006 550991826 550994831 0.000000e+00 5552
1 TraesCS3A01G311700 chr3A 98.307 3012 45 3 1 3006 734137339 734134328 0.000000e+00 5275
2 TraesCS3A01G311700 chr3A 97.576 3012 63 6 1 3006 18252148 18249141 0.000000e+00 5149
3 TraesCS3A01G311700 chr3A 88.129 2207 231 17 815 3006 706253112 706255302 0.000000e+00 2595
4 TraesCS3A01G311700 chr4A 98.473 3012 39 4 1 3006 584413411 584410401 0.000000e+00 5301
5 TraesCS3A01G311700 chr6A 97.876 3013 42 7 1 3006 5067154 5070151 0.000000e+00 5190
6 TraesCS3A01G311700 chr2A 97.609 3011 59 7 1 3006 152005103 152002101 0.000000e+00 5149
7 TraesCS3A01G311700 chr5D 91.154 2227 148 16 815 3006 432138392 432136180 0.000000e+00 2976
8 TraesCS3A01G311700 chr5D 83.929 504 52 16 23 502 432139319 432138821 3.530000e-124 455
9 TraesCS3A01G311700 chr5D 82.609 322 31 13 500 809 432138744 432138436 8.270000e-66 261
10 TraesCS3A01G311700 chr1D 92.993 1841 110 9 1171 3006 13203606 13201780 0.000000e+00 2667
11 TraesCS3A01G311700 chr1D 86.255 502 44 12 23 502 13204248 13203750 3.430000e-144 521
12 TraesCS3A01G311700 chr3B 87.398 2206 248 14 815 3006 3118209 3116020 0.000000e+00 2507
13 TraesCS3A01G311700 chr3B 80.762 499 67 12 23 502 3119264 3118776 2.200000e-96 363
14 TraesCS3A01G311700 chr6D 84.770 499 49 14 29 502 325709512 325709016 2.710000e-130 475
15 TraesCS3A01G311700 chr6D 80.556 468 41 26 500 928 325708939 325708483 6.260000e-82 315


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G311700 chr3A 550991826 550994831 3005 False 5552.000000 5552 100.000000 1 3006 1 chr3A.!!$F1 3005
1 TraesCS3A01G311700 chr3A 734134328 734137339 3011 True 5275.000000 5275 98.307000 1 3006 1 chr3A.!!$R2 3005
2 TraesCS3A01G311700 chr3A 18249141 18252148 3007 True 5149.000000 5149 97.576000 1 3006 1 chr3A.!!$R1 3005
3 TraesCS3A01G311700 chr3A 706253112 706255302 2190 False 2595.000000 2595 88.129000 815 3006 1 chr3A.!!$F2 2191
4 TraesCS3A01G311700 chr4A 584410401 584413411 3010 True 5301.000000 5301 98.473000 1 3006 1 chr4A.!!$R1 3005
5 TraesCS3A01G311700 chr6A 5067154 5070151 2997 False 5190.000000 5190 97.876000 1 3006 1 chr6A.!!$F1 3005
6 TraesCS3A01G311700 chr2A 152002101 152005103 3002 True 5149.000000 5149 97.609000 1 3006 1 chr2A.!!$R1 3005
7 TraesCS3A01G311700 chr5D 432136180 432139319 3139 True 1230.666667 2976 85.897333 23 3006 3 chr5D.!!$R1 2983
8 TraesCS3A01G311700 chr1D 13201780 13204248 2468 True 1594.000000 2667 89.624000 23 3006 2 chr1D.!!$R1 2983
9 TraesCS3A01G311700 chr3B 3116020 3119264 3244 True 1435.000000 2507 84.080000 23 3006 2 chr3B.!!$R1 2983
10 TraesCS3A01G311700 chr6D 325708483 325709512 1029 True 395.000000 475 82.663000 29 928 2 chr6D.!!$R1 899

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
106 107 1.981254 ATTTTGGCGCAGAATCAACG 58.019 45.000 10.83 0.0 0.0 4.10 F
640 891 5.009610 GTGGTGTTGCTCTGAATAAAAAGGA 59.990 40.000 0.00 0.0 0.0 3.36 F
1115 1418 1.774254 TGACAGAAAGATGGTGGTGGT 59.226 47.619 0.00 0.0 0.0 4.16 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1086 1389 3.432749 CCATCTTTCTGTCACGATCCCAT 60.433 47.826 0.00 0.0 0.00 4.00 R
1745 2051 8.954350 CAGTTTCAGGTATCTCTCATGAAAATT 58.046 33.333 0.00 0.0 40.44 1.82 R
2845 3189 4.864247 CCGCCTGGAAAATTTTATCTTGTG 59.136 41.667 2.75 0.0 37.49 3.33 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
106 107 1.981254 ATTTTGGCGCAGAATCAACG 58.019 45.000 10.83 0.0 0.00 4.10
640 891 5.009610 GTGGTGTTGCTCTGAATAAAAAGGA 59.990 40.000 0.00 0.0 0.00 3.36
872 1171 7.962995 TCTAGTAGAGTCAAGTGGAATCATT 57.037 36.000 0.00 0.0 42.95 2.57
1086 1389 8.934023 ACTTAATATCTGAAAGTGGTTTTGGA 57.066 30.769 0.00 0.0 32.38 3.53
1115 1418 1.774254 TGACAGAAAGATGGTGGTGGT 59.226 47.619 0.00 0.0 0.00 4.16
1511 1817 6.826231 TGAAGAGGATAGTGAAAACACAAACA 59.174 34.615 0.00 0.0 0.00 2.83
1745 2051 5.316167 AGCAAAAGATGACCAGTATTGACA 58.684 37.500 0.00 0.0 0.00 3.58
2448 2792 3.725490 CATCTCGCATCTCATTTCCAGA 58.275 45.455 0.00 0.0 0.00 3.86
2558 2902 3.423539 TTGTAGCTCTGTCAGGCAATT 57.576 42.857 13.61 0.0 0.00 2.32
2845 3189 2.621055 TGTATTTGCATAACCCGCATCC 59.379 45.455 0.00 0.0 39.58 3.51
2934 3278 0.036577 GATGCAGATCCCTCCCATCG 60.037 60.000 0.00 0.0 0.00 3.84
2982 3326 5.243507 TGTCAAAGTCACATGCAACCATTAT 59.756 36.000 0.00 0.0 0.00 1.28
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
18 19 4.508405 GGGAGTGCTAGAGATAGGAGACAT 60.508 50.000 0.00 0.00 0.00 3.06
106 107 3.050275 GCTCCGTTGGTGCTCCAC 61.050 66.667 7.09 2.36 44.22 4.02
411 438 8.896722 AACAAGTAGAAGTAGATCTTTCCCTA 57.103 34.615 0.00 0.00 36.40 3.53
858 1157 5.824624 GCCTTCATCTAATGATTCCACTTGA 59.175 40.000 0.00 0.00 39.39 3.02
872 1171 6.737720 ACAGTTGAGATATGCCTTCATCTA 57.262 37.500 0.00 0.00 31.63 1.98
1086 1389 3.432749 CCATCTTTCTGTCACGATCCCAT 60.433 47.826 0.00 0.00 0.00 4.00
1511 1817 9.686683 ACTGAATGTATTATTGCTAGAAAACCT 57.313 29.630 0.00 0.00 0.00 3.50
1745 2051 8.954350 CAGTTTCAGGTATCTCTCATGAAAATT 58.046 33.333 0.00 0.00 40.44 1.82
2558 2902 9.987272 CATAAGACTACACAATGGAGATATGAA 57.013 33.333 0.00 0.00 31.25 2.57
2845 3189 4.864247 CCGCCTGGAAAATTTTATCTTGTG 59.136 41.667 2.75 0.00 37.49 3.33


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.