Multiple sequence alignment - TraesCS3A01G307400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G307400 chr3A 100.000 2398 0 0 1 2398 545676422 545674025 0.000000e+00 4429
1 TraesCS3A01G307400 chr3A 97.416 2399 60 2 1 2398 171150130 171152527 0.000000e+00 4085
2 TraesCS3A01G307400 chr3A 96.583 2400 62 9 1 2398 58078401 58076020 0.000000e+00 3960
3 TraesCS3A01G307400 chr3A 97.008 1805 51 2 594 2398 122115255 122117056 0.000000e+00 3031
4 TraesCS3A01G307400 chr3A 96.735 1807 57 1 594 2398 48905594 48907400 0.000000e+00 3009
5 TraesCS3A01G307400 chr1A 97.375 2400 60 3 1 2398 359190689 359193087 0.000000e+00 4080
6 TraesCS3A01G307400 chr1A 97.125 2400 66 3 1 2398 181970720 181968322 0.000000e+00 4047
7 TraesCS3A01G307400 chr1A 96.375 2400 68 7 1 2398 579041650 579039268 0.000000e+00 3932
8 TraesCS3A01G307400 chr1A 96.491 2337 66 4 63 2398 67962183 67959862 0.000000e+00 3847
9 TraesCS3A01G307400 chr7A 96.565 1805 60 1 594 2398 723589399 723591201 0.000000e+00 2988
10 TraesCS3A01G307400 chr7A 95.327 535 24 1 63 596 662680420 662680954 0.000000e+00 848
11 TraesCS3A01G307400 chr7A 100.000 65 0 0 1 65 662679752 662679816 1.160000e-23 121
12 TraesCS3A01G307400 chr1D 94.177 498 25 3 63 559 308936650 308937144 0.000000e+00 756
13 TraesCS3A01G307400 chr4D 94.177 498 24 3 63 559 446550868 446550375 0.000000e+00 754
14 TraesCS3A01G307400 chr4D 100.000 65 0 0 1 65 99934203 99934267 1.160000e-23 121
15 TraesCS3A01G307400 chr4D 98.462 65 1 0 1 65 446551532 446551468 5.420000e-22 115
16 TraesCS3A01G307400 chr7B 100.000 65 0 0 1 65 574900461 574900397 1.160000e-23 121


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G307400 chr3A 545674025 545676422 2397 True 4429.0 4429 100.0000 1 2398 1 chr3A.!!$R2 2397
1 TraesCS3A01G307400 chr3A 171150130 171152527 2397 False 4085.0 4085 97.4160 1 2398 1 chr3A.!!$F3 2397
2 TraesCS3A01G307400 chr3A 58076020 58078401 2381 True 3960.0 3960 96.5830 1 2398 1 chr3A.!!$R1 2397
3 TraesCS3A01G307400 chr3A 122115255 122117056 1801 False 3031.0 3031 97.0080 594 2398 1 chr3A.!!$F2 1804
4 TraesCS3A01G307400 chr3A 48905594 48907400 1806 False 3009.0 3009 96.7350 594 2398 1 chr3A.!!$F1 1804
5 TraesCS3A01G307400 chr1A 359190689 359193087 2398 False 4080.0 4080 97.3750 1 2398 1 chr1A.!!$F1 2397
6 TraesCS3A01G307400 chr1A 181968322 181970720 2398 True 4047.0 4047 97.1250 1 2398 1 chr1A.!!$R2 2397
7 TraesCS3A01G307400 chr1A 579039268 579041650 2382 True 3932.0 3932 96.3750 1 2398 1 chr1A.!!$R3 2397
8 TraesCS3A01G307400 chr1A 67959862 67962183 2321 True 3847.0 3847 96.4910 63 2398 1 chr1A.!!$R1 2335
9 TraesCS3A01G307400 chr7A 723589399 723591201 1802 False 2988.0 2988 96.5650 594 2398 1 chr7A.!!$F1 1804
10 TraesCS3A01G307400 chr7A 662679752 662680954 1202 False 484.5 848 97.6635 1 596 2 chr7A.!!$F2 595
11 TraesCS3A01G307400 chr4D 446550375 446551532 1157 True 434.5 754 96.3195 1 559 2 chr4D.!!$R1 558

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
142 750 0.335361 AAGCGGTCCCTCTCTCCTAA 59.665 55.0 0.0 0.0 0.0 2.69 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1397 2006 1.298953 ATCATAGCACACAAGGGGGT 58.701 50.0 0.0 0.0 0.0 4.95 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
116 723 8.508883 TTAGCTCTTGTTAGTTGGTTTTGTTA 57.491 30.769 0.00 0.00 0.00 2.41
119 726 8.474831 AGCTCTTGTTAGTTGGTTTTGTTATTT 58.525 29.630 0.00 0.00 0.00 1.40
129 737 5.903810 TGGTTTTGTTATTTTACAAGCGGT 58.096 33.333 0.00 0.00 39.06 5.68
142 750 0.335361 AAGCGGTCCCTCTCTCCTAA 59.665 55.000 0.00 0.00 0.00 2.69
238 846 8.822805 TGTTCCTTTCTTCCTTATAAAGCTAGA 58.177 33.333 0.00 0.00 0.00 2.43
365 973 2.032681 GAAGGTGCCCGAAGCTGT 59.967 61.111 0.00 0.00 44.23 4.40
403 1011 4.761739 ACTGATGTTTACATGTTGGGTCAG 59.238 41.667 2.30 13.73 36.57 3.51
503 1111 7.646526 GGACTGTCCGTTTAATTTATAAATGGC 59.353 37.037 11.71 0.66 41.20 4.40
660 1268 1.078708 GTGTATGGTGGTGACCCCG 60.079 63.158 0.00 0.00 42.34 5.73
663 1271 3.935456 TATGGTGGTGACCCCGGCT 62.935 63.158 0.00 0.00 42.34 5.52
918 1526 8.474025 TGTCCACTCTTGTTTTGTTAATTCATT 58.526 29.630 0.00 0.00 0.00 2.57
1157 1765 6.549364 TGTAGATTTGATGGGTTCAACAACTT 59.451 34.615 0.00 0.00 43.99 2.66
1365 1974 6.350110 GCTGGATGTGTTTTGCCTTAATTCTA 60.350 38.462 0.00 0.00 0.00 2.10
1366 1975 6.919721 TGGATGTGTTTTGCCTTAATTCTAC 58.080 36.000 0.00 0.00 0.00 2.59
1821 2433 6.818644 GTGTTAGTCACTCCATGAACACATAT 59.181 38.462 13.46 0.00 42.48 1.78
1919 2531 5.412594 TCATTGGCTACTGTTTGATGTTCTC 59.587 40.000 0.00 0.00 0.00 2.87
1931 2543 8.315391 TGTTTGATGTTCTCTACAGATTCTTG 57.685 34.615 0.00 0.00 40.83 3.02
1935 2547 7.670364 TGATGTTCTCTACAGATTCTTGTTCA 58.330 34.615 0.00 0.00 40.83 3.18
2064 2677 3.654273 AGTAGGCTTATCTGGGCTGTAA 58.346 45.455 0.00 0.00 39.87 2.41
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
110 717 4.828387 AGGGACCGCTTGTAAAATAACAAA 59.172 37.500 0.00 0.00 38.81 2.83
116 723 2.572104 AGAGAGGGACCGCTTGTAAAAT 59.428 45.455 0.00 0.00 0.00 1.82
119 726 1.183549 GAGAGAGGGACCGCTTGTAA 58.816 55.000 0.00 0.00 0.00 2.41
129 737 9.540538 CAGAATTATATCTTTAGGAGAGAGGGA 57.459 37.037 0.00 0.00 37.93 4.20
142 750 5.653255 ACCTGCACCCAGAATTATATCTT 57.347 39.130 0.00 0.00 41.77 2.40
242 850 7.547019 TGCAAAAGTGTGTCAATTTCAATACAA 59.453 29.630 0.00 0.00 30.35 2.41
244 852 7.462109 TGCAAAAGTGTGTCAATTTCAATAC 57.538 32.000 0.00 0.00 30.35 1.89
369 977 0.534877 AACATCAGTCACTTGCCGCA 60.535 50.000 0.00 0.00 0.00 5.69
403 1011 6.424509 TCTGCAACAACAAATGATTTTCATCC 59.575 34.615 0.00 0.00 35.76 3.51
503 1111 1.597742 ACAGCAGCAACAACAGGTAG 58.402 50.000 0.00 0.00 0.00 3.18
585 1193 5.129485 TGTCCTTGAAGTTCTCTGAGTTCTT 59.871 40.000 4.32 10.04 31.65 2.52
660 1268 4.106925 CTGGGGAGTCCTGCAGCC 62.107 72.222 8.66 3.56 36.20 4.85
1085 1693 1.625508 GGGTAGGGGGTCTCTCACATT 60.626 57.143 0.00 0.00 0.00 2.71
1184 1792 2.094700 GCCTGACACTTCATCGACACTA 60.095 50.000 0.00 0.00 0.00 2.74
1386 1995 3.181430 ACACAAGGGGGTTAAATAACGGT 60.181 43.478 0.00 0.00 37.07 4.83
1397 2006 1.298953 ATCATAGCACACAAGGGGGT 58.701 50.000 0.00 0.00 0.00 4.95
1447 2058 3.706698 TCATACAGCAGATACACGAAGC 58.293 45.455 0.00 0.00 0.00 3.86
2323 2937 7.224297 TCTAAGATGCAACCTTTTACAGTCTT 58.776 34.615 9.55 3.55 0.00 3.01


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.