Multiple sequence alignment - TraesCS3A01G306100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G306100 chr3A 100.000 2513 0 0 1 2513 542252250 542254762 0 4641
1 TraesCS3A01G306100 chr3A 96.955 2003 57 4 511 2511 654167488 654169488 0 3358
2 TraesCS3A01G306100 chr5A 97.706 2005 42 4 511 2511 639808519 639810523 0 3445
3 TraesCS3A01G306100 chr5A 97.552 2002 47 2 511 2511 580224842 580222842 0 3424
4 TraesCS3A01G306100 chr5A 96.959 2006 55 5 511 2511 483355089 483353085 0 3362
5 TraesCS3A01G306100 chr5A 96.154 520 12 6 1 517 580225707 580225193 0 843
6 TraesCS3A01G306100 chr5A 96.154 520 13 5 1 517 639807653 639808168 0 843
7 TraesCS3A01G306100 chr5A 96.139 518 12 7 1 517 673332764 673332254 0 839
8 TraesCS3A01G306100 chr6A 97.406 2005 45 6 511 2511 468224811 468226812 0 3408
9 TraesCS3A01G306100 chr6A 96.808 2005 56 8 511 2511 461948275 461950275 0 3341
10 TraesCS3A01G306100 chr6A 95.954 519 14 6 1 517 468223947 468224460 0 835
11 TraesCS3A01G306100 chr1A 97.013 2009 52 7 511 2511 257590870 257588862 0 3371
12 TraesCS3A01G306100 chr1A 96.853 2002 61 2 511 2511 549993574 549991574 0 3347
13 TraesCS3A01G306100 chr1A 95.954 519 14 6 1 517 257591734 257591221 0 835
14 TraesCS3A01G306100 chr1A 95.946 518 16 4 1 517 582805655 582806168 0 835
15 TraesCS3A01G306100 chr7A 96.956 2004 56 4 511 2511 709084252 709082251 0 3358
16 TraesCS3A01G306100 chr7A 95.954 519 14 6 1 517 709085126 709084613 0 835
17 TraesCS3A01G306100 chr2A 96.538 520 11 5 1 517 538374089 538373574 0 854
18 TraesCS3A01G306100 chr5B 95.946 518 16 4 1 517 192447278 192447791 0 835


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G306100 chr3A 542252250 542254762 2512 False 4641.0 4641 100.0000 1 2513 1 chr3A.!!$F1 2512
1 TraesCS3A01G306100 chr3A 654167488 654169488 2000 False 3358.0 3358 96.9550 511 2511 1 chr3A.!!$F2 2000
2 TraesCS3A01G306100 chr5A 483353085 483355089 2004 True 3362.0 3362 96.9590 511 2511 1 chr5A.!!$R1 2000
3 TraesCS3A01G306100 chr5A 639807653 639810523 2870 False 2144.0 3445 96.9300 1 2511 2 chr5A.!!$F1 2510
4 TraesCS3A01G306100 chr5A 580222842 580225707 2865 True 2133.5 3424 96.8530 1 2511 2 chr5A.!!$R3 2510
5 TraesCS3A01G306100 chr5A 673332254 673332764 510 True 839.0 839 96.1390 1 517 1 chr5A.!!$R2 516
6 TraesCS3A01G306100 chr6A 461948275 461950275 2000 False 3341.0 3341 96.8080 511 2511 1 chr6A.!!$F1 2000
7 TraesCS3A01G306100 chr6A 468223947 468226812 2865 False 2121.5 3408 96.6800 1 2511 2 chr6A.!!$F2 2510
8 TraesCS3A01G306100 chr1A 549991574 549993574 2000 True 3347.0 3347 96.8530 511 2511 1 chr1A.!!$R1 2000
9 TraesCS3A01G306100 chr1A 257588862 257591734 2872 True 2103.0 3371 96.4835 1 2511 2 chr1A.!!$R2 2510
10 TraesCS3A01G306100 chr1A 582805655 582806168 513 False 835.0 835 95.9460 1 517 1 chr1A.!!$F1 516
11 TraesCS3A01G306100 chr7A 709082251 709085126 2875 True 2096.5 3358 96.4550 1 2511 2 chr7A.!!$R1 2510
12 TraesCS3A01G306100 chr2A 538373574 538374089 515 True 854.0 854 96.5380 1 517 1 chr2A.!!$R1 516
13 TraesCS3A01G306100 chr5B 192447278 192447791 513 False 835.0 835 95.9460 1 517 1 chr5B.!!$F1 516

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
657 1036 0.038251 GATCCGCGTGATGCATCCTA 60.038 55.0 23.67 3.18 46.97 2.94 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1804 2187 3.555917 ACTAACGAACTCGAGGACAAG 57.444 47.619 18.41 8.59 43.02 3.16 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
90 91 8.130307 CAAAATTTGGATTCGAGTCAAAGTTT 57.870 30.769 19.64 19.64 44.12 2.66
139 140 2.268298 GTGCGGTGTATTTGATCGAGT 58.732 47.619 0.00 0.00 0.00 4.18
170 171 5.648092 AGTCCAATATTTGTAGGTGAACAGC 59.352 40.000 0.00 0.00 0.00 4.40
480 483 9.513727 GAAGCTATGGAGATTTTTCTGATTTTC 57.486 33.333 0.00 0.00 29.33 2.29
657 1036 0.038251 GATCCGCGTGATGCATCCTA 60.038 55.000 23.67 3.18 46.97 2.94
683 1063 1.542030 CTACTGCACTGTCCTTCTCGT 59.458 52.381 0.00 0.00 0.00 4.18
738 1118 5.990745 AATTGTATTTTTCGCACATGACG 57.009 34.783 0.00 2.72 0.00 4.35
838 1219 2.699846 CCTTCTCCTCTTCTCCATCTGG 59.300 54.545 0.00 0.00 0.00 3.86
1074 1455 3.135530 CGAAGGAGGAGAAGAATGGGAAT 59.864 47.826 0.00 0.00 0.00 3.01
1303 1684 0.918983 TTCGAGGGGGAATGCAATCT 59.081 50.000 1.01 0.00 0.00 2.40
1647 2029 2.589798 TCGACACTTTCAGTTTCGGT 57.410 45.000 11.43 0.00 45.44 4.69
1707 2090 8.229253 TGTTAGCTAATAACCTCGAGTATTGA 57.771 34.615 9.88 0.00 42.74 2.57
1732 2115 5.012893 TCATACCATAGCTCGTCAGATGAT 58.987 41.667 0.00 0.00 0.00 2.45
1802 2185 1.202639 TCTCTCTCGCACTTGCCAAAA 60.203 47.619 0.00 0.00 37.91 2.44
1804 2187 1.806542 TCTCTCGCACTTGCCAAAATC 59.193 47.619 0.00 0.00 37.91 2.17
2511 2907 3.309682 CACACACCAAACTCACACTACAG 59.690 47.826 0.00 0.00 0.00 2.74
2512 2908 3.196901 ACACACCAAACTCACACTACAGA 59.803 43.478 0.00 0.00 0.00 3.41
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
139 140 9.967451 TCACCTACAAATATTGGACTTCAAATA 57.033 29.630 0.00 0.00 39.05 1.40
170 171 5.159209 GTTTCTGCACATTTCTCATTCAGG 58.841 41.667 0.00 0.00 0.00 3.86
507 514 4.782156 TCAACGGGGTAATTAGGGTTTAGA 59.218 41.667 0.00 0.00 0.00 2.10
520 898 0.968901 ATGAGCGAGTCAACGGGGTA 60.969 55.000 0.00 0.00 39.19 3.69
657 1036 1.352352 AGGACAGTGCAGTAGCCAATT 59.648 47.619 12.80 0.00 41.13 2.32
738 1118 6.073222 CCAACTCTTAACACTAACATGTGGTC 60.073 42.308 0.00 0.00 41.84 4.02
748 1128 9.796120 CAATTTTTGAACCAACTCTTAACACTA 57.204 29.630 0.00 0.00 0.00 2.74
838 1219 1.300971 TGCTCGATGCCTTTGTCTGC 61.301 55.000 4.73 0.00 42.00 4.26
1074 1455 2.589442 ACGAACTCGCGCCCAAAA 60.589 55.556 0.00 0.00 44.43 2.44
1202 1583 7.029563 GTGGCATTTCTTCACGATCTAAAAAT 58.970 34.615 0.00 0.00 0.00 1.82
1207 1588 3.055458 TGGTGGCATTTCTTCACGATCTA 60.055 43.478 0.00 0.00 32.65 1.98
1303 1684 2.268920 GGGCAGATTGGACTCGCA 59.731 61.111 0.00 0.00 0.00 5.10
1597 1979 6.855836 ACAGTAAATTGCATACATTCAGTGG 58.144 36.000 0.00 0.00 0.00 4.00
1647 2029 5.492895 TCACTGAACTGGTGTTGTTTTCTA 58.507 37.500 0.00 0.00 36.39 2.10
1707 2090 5.478332 TCATCTGACGAGCTATGGTATGATT 59.522 40.000 0.00 0.00 0.00 2.57
1732 2115 7.165460 TGTGCTGCTCAAGTAATACTTACTA 57.835 36.000 5.23 0.00 45.33 1.82
1802 2185 3.757493 ACTAACGAACTCGAGGACAAGAT 59.243 43.478 18.41 0.95 43.02 2.40
1804 2187 3.555917 ACTAACGAACTCGAGGACAAG 57.444 47.619 18.41 8.59 43.02 3.16


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.