Multiple sequence alignment - TraesCS3A01G286300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G286300 chr3A 100.000 2285 0 0 1 2285 514528939 514531223 0.000000e+00 4220
1 TraesCS3A01G286300 chr3A 98.863 2287 24 2 1 2285 627956951 627954665 0.000000e+00 4078
2 TraesCS3A01G286300 chr6A 98.732 2287 27 2 1 2285 214163119 214160833 0.000000e+00 4061
3 TraesCS3A01G286300 chr6B 98.645 2287 28 3 1 2285 439442975 439440690 0.000000e+00 4048
4 TraesCS3A01G286300 chr7A 98.338 2287 36 2 1 2285 613755278 613752992 0.000000e+00 4012
5 TraesCS3A01G286300 chr7B 98.164 2288 37 4 1 2285 577195721 577193436 0.000000e+00 3988
6 TraesCS3A01G286300 chr1A 98.033 2288 42 3 1 2285 64891389 64889102 0.000000e+00 3973
7 TraesCS3A01G286300 chr5B 98.159 2118 25 4 117 2232 255655796 255657901 0.000000e+00 3683
8 TraesCS3A01G286300 chr5B 98.717 1949 24 1 338 2285 524582648 524580700 0.000000e+00 3459
9 TraesCS3A01G286300 chr1B 95.526 2235 74 11 1 2232 631842861 631845072 0.000000e+00 3550
10 TraesCS3A01G286300 chr2B 98.792 414 3 1 1 412 708697865 708697452 0.000000e+00 736
11 TraesCS3A01G286300 chr2B 82.591 247 22 6 1 246 161808458 161808684 4.980000e-47 198


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G286300 chr3A 514528939 514531223 2284 False 4220 4220 100.000 1 2285 1 chr3A.!!$F1 2284
1 TraesCS3A01G286300 chr3A 627954665 627956951 2286 True 4078 4078 98.863 1 2285 1 chr3A.!!$R1 2284
2 TraesCS3A01G286300 chr6A 214160833 214163119 2286 True 4061 4061 98.732 1 2285 1 chr6A.!!$R1 2284
3 TraesCS3A01G286300 chr6B 439440690 439442975 2285 True 4048 4048 98.645 1 2285 1 chr6B.!!$R1 2284
4 TraesCS3A01G286300 chr7A 613752992 613755278 2286 True 4012 4012 98.338 1 2285 1 chr7A.!!$R1 2284
5 TraesCS3A01G286300 chr7B 577193436 577195721 2285 True 3988 3988 98.164 1 2285 1 chr7B.!!$R1 2284
6 TraesCS3A01G286300 chr1A 64889102 64891389 2287 True 3973 3973 98.033 1 2285 1 chr1A.!!$R1 2284
7 TraesCS3A01G286300 chr5B 255655796 255657901 2105 False 3683 3683 98.159 117 2232 1 chr5B.!!$F1 2115
8 TraesCS3A01G286300 chr5B 524580700 524582648 1948 True 3459 3459 98.717 338 2285 1 chr5B.!!$R1 1947
9 TraesCS3A01G286300 chr1B 631842861 631845072 2211 False 3550 3550 95.526 1 2232 1 chr1B.!!$F1 2231

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
366 369 1.300931 ACTACACAGTGCAGCACCG 60.301 57.895 22.41 14.92 34.49 4.94 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1999 2004 0.457035 CCAACATTTAGGCGCTGCAT 59.543 50.0 7.64 0.0 0.0 3.96 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
108 110 4.096003 AACGGGTAGGCGCTGCAT 62.096 61.111 7.64 0.00 0.00 3.96
366 369 1.300931 ACTACACAGTGCAGCACCG 60.301 57.895 22.41 14.92 34.49 4.94
386 389 2.186903 GCCTTAGGCGCTGCACTA 59.813 61.111 7.77 0.00 39.62 2.74
387 390 1.449601 GCCTTAGGCGCTGCACTAA 60.450 57.895 7.77 5.49 39.62 2.24
388 391 1.706287 GCCTTAGGCGCTGCACTAAC 61.706 60.000 7.77 0.00 39.62 2.34
1999 2004 2.281208 GGGCGCCACACAGTACAA 60.281 61.111 30.85 0.00 0.00 2.41
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
108 110 5.295787 CACCACAAAAACTGCTAAGTCAGTA 59.704 40.000 0.00 0.00 45.77 2.74
190 192 2.221299 TGGCGCCTTGACCTTAGGT 61.221 57.895 29.70 2.34 39.44 3.08
386 389 2.743928 GCTAGGCGCTGCACTGTT 60.744 61.111 7.64 0.00 35.14 3.16
387 390 4.767255 GGCTAGGCGCTGCACTGT 62.767 66.667 7.64 0.00 39.13 3.55
388 391 3.965539 AAGGCTAGGCGCTGCACTG 62.966 63.158 7.64 0.00 39.13 3.66
1439 1444 0.701147 CTCTTCCTCCAAGCCCCTTT 59.299 55.000 0.00 0.00 31.26 3.11
1839 1844 2.081462 CAATGACTGCAGCATCACAGA 58.919 47.619 15.27 0.00 37.35 3.41
1999 2004 0.457035 CCAACATTTAGGCGCTGCAT 59.543 50.000 7.64 0.00 0.00 3.96


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.