Multiple sequence alignment - TraesCS3A01G271300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G271300 chr3A 100.000 2779 0 0 1 2779 500029062 500031840 0.000000e+00 5132.0
1 TraesCS3A01G271300 chr3A 98.131 1980 34 3 1 1979 40979485 40977508 0.000000e+00 3448.0
2 TraesCS3A01G271300 chr5D 97.929 1980 40 1 1 1979 545192719 545194698 0.000000e+00 3428.0
3 TraesCS3A01G271300 chr4D 97.878 1979 42 0 1 1979 400124735 400126713 0.000000e+00 3422.0
4 TraesCS3A01G271300 chr4D 97.561 41 1 0 1764 1804 400126539 400126579 1.380000e-08 71.3
5 TraesCS3A01G271300 chr6D 97.575 1979 47 1 1 1979 349233 347256 0.000000e+00 3387.0
6 TraesCS3A01G271300 chr6D 97.561 41 1 0 1764 1804 347430 347390 1.380000e-08 71.3
7 TraesCS3A01G271300 chrUn 97.476 1981 41 4 1 1979 43102707 43100734 0.000000e+00 3373.0
8 TraesCS3A01G271300 chr1A 97.325 1981 39 4 1 1979 45391624 45393592 0.000000e+00 3352.0
9 TraesCS3A01G271300 chr1A 95.517 803 28 8 1980 2779 474697737 474696940 0.000000e+00 1277.0
10 TraesCS3A01G271300 chr1A 94.015 802 43 5 1980 2779 474692460 474691662 0.000000e+00 1210.0
11 TraesCS3A01G271300 chr1A 92.777 803 44 13 1983 2779 580246362 580245568 0.000000e+00 1149.0
12 TraesCS3A01G271300 chr4A 96.045 885 35 0 1095 1979 507108534 507107650 0.000000e+00 1441.0
13 TraesCS3A01G271300 chr4A 93.267 802 38 8 1980 2779 550001173 550000386 0.000000e+00 1168.0
14 TraesCS3A01G271300 chr4A 93.159 804 38 9 1980 2779 37265717 37266507 0.000000e+00 1164.0
15 TraesCS3A01G271300 chr4A 93.026 803 40 9 1980 2779 556119239 556120028 0.000000e+00 1158.0
16 TraesCS3A01G271300 chr4A 96.721 61 2 0 1 61 507108591 507108531 4.900000e-18 102.0
17 TraesCS3A01G271300 chr2A 94.132 801 37 5 1980 2778 55795149 55795941 0.000000e+00 1210.0
18 TraesCS3A01G271300 chr2A 93.151 803 35 12 1980 2778 272471231 272470445 0.000000e+00 1160.0
19 TraesCS3A01G271300 chr5A 93.125 800 40 5 1980 2779 422427191 422426407 0.000000e+00 1158.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G271300 chr3A 500029062 500031840 2778 False 5132.00 5132 100.0000 1 2779 1 chr3A.!!$F1 2778
1 TraesCS3A01G271300 chr3A 40977508 40979485 1977 True 3448.00 3448 98.1310 1 1979 1 chr3A.!!$R1 1978
2 TraesCS3A01G271300 chr5D 545192719 545194698 1979 False 3428.00 3428 97.9290 1 1979 1 chr5D.!!$F1 1978
3 TraesCS3A01G271300 chr4D 400124735 400126713 1978 False 1746.65 3422 97.7195 1 1979 2 chr4D.!!$F1 1978
4 TraesCS3A01G271300 chr6D 347256 349233 1977 True 1729.15 3387 97.5680 1 1979 2 chr6D.!!$R1 1978
5 TraesCS3A01G271300 chrUn 43100734 43102707 1973 True 3373.00 3373 97.4760 1 1979 1 chrUn.!!$R1 1978
6 TraesCS3A01G271300 chr1A 45391624 45393592 1968 False 3352.00 3352 97.3250 1 1979 1 chr1A.!!$F1 1978
7 TraesCS3A01G271300 chr1A 474696940 474697737 797 True 1277.00 1277 95.5170 1980 2779 1 chr1A.!!$R2 799
8 TraesCS3A01G271300 chr1A 474691662 474692460 798 True 1210.00 1210 94.0150 1980 2779 1 chr1A.!!$R1 799
9 TraesCS3A01G271300 chr1A 580245568 580246362 794 True 1149.00 1149 92.7770 1983 2779 1 chr1A.!!$R3 796
10 TraesCS3A01G271300 chr4A 550000386 550001173 787 True 1168.00 1168 93.2670 1980 2779 1 chr4A.!!$R1 799
11 TraesCS3A01G271300 chr4A 37265717 37266507 790 False 1164.00 1164 93.1590 1980 2779 1 chr4A.!!$F1 799
12 TraesCS3A01G271300 chr4A 556119239 556120028 789 False 1158.00 1158 93.0260 1980 2779 1 chr4A.!!$F2 799
13 TraesCS3A01G271300 chr4A 507107650 507108591 941 True 771.50 1441 96.3830 1 1979 2 chr4A.!!$R2 1978
14 TraesCS3A01G271300 chr2A 55795149 55795941 792 False 1210.00 1210 94.1320 1980 2778 1 chr2A.!!$F1 798
15 TraesCS3A01G271300 chr2A 272470445 272471231 786 True 1160.00 1160 93.1510 1980 2778 1 chr2A.!!$R1 798
16 TraesCS3A01G271300 chr5A 422426407 422427191 784 True 1158.00 1158 93.1250 1980 2779 1 chr5A.!!$R1 799

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
54 55 0.550914 TCTGTCCCTGTTGCTTGGTT 59.449 50.0 0.0 0.0 0.0 3.67 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2017 2024 1.019673 ATCACCATGATCTTGCGTGC 58.98 50.0 17.75 0.0 29.59 5.34 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
54 55 0.550914 TCTGTCCCTGTTGCTTGGTT 59.449 50.000 0.00 0.0 0.00 3.67
149 150 9.899661 ACATGTTGCTATTTTTACTACCATCTA 57.100 29.630 0.00 0.0 0.00 1.98
258 260 4.750098 CACACCAGAATCGACAAACTACTT 59.250 41.667 0.00 0.0 0.00 2.24
276 278 9.740710 AAACTACTTAGCAAGAATCTGGTAATT 57.259 29.630 3.37 0.0 38.30 1.40
354 356 7.920682 CCTGGCAATATGTACATTTCCTTAAAC 59.079 37.037 14.77 0.0 0.00 2.01
641 643 9.982651 GGTATGTACTAGCTTGAAATATTCTCA 57.017 33.333 1.04 0.0 0.00 3.27
1128 1134 6.655078 ATTTCCAGCATTACTGTTGACTTT 57.345 33.333 0.00 0.0 45.68 2.66
1538 1544 7.391148 TGTCATCATTCCTTTTTAGGCTAAC 57.609 36.000 6.43 0.0 0.00 2.34
1562 1568 4.145052 GGGATTTGGAGGACACATATTCC 58.855 47.826 0.00 0.0 0.00 3.01
2070 2077 2.160721 GGGGGAGAGTGTGATCTACA 57.839 55.000 0.00 0.0 36.82 2.74
2071 2078 2.035632 GGGGGAGAGTGTGATCTACAG 58.964 57.143 0.00 0.0 40.69 2.74
2149 2164 2.892425 GCCCGACCGATCAAGCAG 60.892 66.667 0.00 0.0 0.00 4.24
2228 2243 0.389817 CCGATCCAGCAAAGTGTCGA 60.390 55.000 0.00 0.0 0.00 4.20
2281 2296 6.273825 GTGACGATCTTGATGTACTACCATT 58.726 40.000 0.00 0.0 0.00 3.16
2316 2331 5.411669 GCCTAAGCACCGCTACAATATTATT 59.588 40.000 0.00 0.0 38.25 1.40
2395 2413 0.178903 TTGTGTCTCTAGGGGTGCCT 60.179 55.000 0.00 0.0 0.00 4.75
2396 2414 0.178903 TGTGTCTCTAGGGGTGCCTT 60.179 55.000 0.00 0.0 0.00 4.35
2582 2609 3.388913 CCCCTCTCTCCTTGTCCTATTT 58.611 50.000 0.00 0.0 0.00 1.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
213 215 3.563390 GCCAAGATGGTATCTTCTCTTGC 59.437 47.826 1.26 1.68 46.17 4.01
258 260 9.905713 ATAGTTCAAATTACCAGATTCTTGCTA 57.094 29.630 0.00 0.00 0.00 3.49
343 345 4.200092 GAGAGGCCATCGTTTAAGGAAAT 58.800 43.478 5.01 0.00 0.00 2.17
354 356 1.144936 GAGGGTTGAGAGGCCATCG 59.855 63.158 5.01 0.00 0.00 3.84
957 963 8.076910 AGCCATTGTACAATTAATTGATCCAA 57.923 30.769 30.18 25.25 40.14 3.53
1072 1078 1.550659 GCTTTTGTACGACGTCGGCA 61.551 55.000 37.89 31.30 44.95 5.69
1128 1134 1.748244 GCCATGCAGTCATAAGGAGCA 60.748 52.381 0.00 0.00 39.79 4.26
1538 1544 2.814805 ATGTGTCCTCCAAATCCCAG 57.185 50.000 0.00 0.00 0.00 4.45
1562 1568 7.061789 GCAATTGTTAGTATTTTTCCCTTCGTG 59.938 37.037 7.40 0.00 0.00 4.35
1739 1745 9.701098 CTAGTAATGTACACAAAAGTAACCTGA 57.299 33.333 0.00 0.00 0.00 3.86
1750 1756 9.300681 ACTTACTACACCTAGTAATGTACACAA 57.699 33.333 0.00 0.00 42.23 3.33
1793 1799 5.127356 ACTTACTACACCTAAGAGGCATGTC 59.873 44.000 0.00 0.00 39.63 3.06
1920 1926 5.361427 TCTGTGAGTACGATTTTGAACCAA 58.639 37.500 0.00 0.00 0.00 3.67
2017 2024 1.019673 ATCACCATGATCTTGCGTGC 58.980 50.000 17.75 0.00 29.59 5.34
2070 2077 2.163815 CGTTGTCGATCTACAAGGGTCT 59.836 50.000 19.59 0.00 39.92 3.85
2071 2078 2.527100 CGTTGTCGATCTACAAGGGTC 58.473 52.381 19.59 6.63 39.92 4.46
2149 2164 1.069378 CGGAGGTGTCGTAGTTTCGC 61.069 60.000 0.00 0.00 0.00 4.70
2316 2331 1.625228 CCCCTTCCACCATAGTCCTCA 60.625 57.143 0.00 0.00 0.00 3.86
2395 2413 5.991861 TGAACCTTTATATACGGAGGCAAA 58.008 37.500 4.64 0.00 32.42 3.68
2396 2414 5.617528 TGAACCTTTATATACGGAGGCAA 57.382 39.130 4.64 0.00 32.42 4.52


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.