Multiple sequence alignment - TraesCS3A01G269300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G269300 chr3A 100.000 2507 0 0 1 2507 495417484 495419990 0 4630
1 TraesCS3A01G269300 chr3A 95.817 2510 101 4 1 2507 686033089 686030581 0 4050
2 TraesCS3A01G269300 chr4A 95.938 2511 96 6 1 2507 135268669 135271177 0 4067
3 TraesCS3A01G269300 chr4A 95.857 2510 100 4 1 2507 468968745 468966237 0 4056
4 TraesCS3A01G269300 chr5A 95.898 2511 97 5 1 2507 410782665 410780157 0 4061
5 TraesCS3A01G269300 chr5A 95.815 2509 101 4 1 2507 653324845 653322339 0 4048
6 TraesCS3A01G269300 chr2A 95.933 2508 97 5 1 2505 512259364 512261869 0 4061
7 TraesCS3A01G269300 chr6A 95.817 2510 101 4 1 2507 356995131 356997639 0 4050
8 TraesCS3A01G269300 chr6A 95.817 2510 99 5 1 2507 151331996 151334502 0 4048
9 TraesCS3A01G269300 chr7A 95.815 2509 101 4 1 2507 251298819 251301325 0 4048


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G269300 chr3A 495417484 495419990 2506 False 4630 4630 100.000 1 2507 1 chr3A.!!$F1 2506
1 TraesCS3A01G269300 chr3A 686030581 686033089 2508 True 4050 4050 95.817 1 2507 1 chr3A.!!$R1 2506
2 TraesCS3A01G269300 chr4A 135268669 135271177 2508 False 4067 4067 95.938 1 2507 1 chr4A.!!$F1 2506
3 TraesCS3A01G269300 chr4A 468966237 468968745 2508 True 4056 4056 95.857 1 2507 1 chr4A.!!$R1 2506
4 TraesCS3A01G269300 chr5A 410780157 410782665 2508 True 4061 4061 95.898 1 2507 1 chr5A.!!$R1 2506
5 TraesCS3A01G269300 chr5A 653322339 653324845 2506 True 4048 4048 95.815 1 2507 1 chr5A.!!$R2 2506
6 TraesCS3A01G269300 chr2A 512259364 512261869 2505 False 4061 4061 95.933 1 2505 1 chr2A.!!$F1 2504
7 TraesCS3A01G269300 chr6A 356995131 356997639 2508 False 4050 4050 95.817 1 2507 1 chr6A.!!$F2 2506
8 TraesCS3A01G269300 chr6A 151331996 151334502 2506 False 4048 4048 95.817 1 2507 1 chr6A.!!$F1 2506
9 TraesCS3A01G269300 chr7A 251298819 251301325 2506 False 4048 4048 95.815 1 2507 1 chr7A.!!$F1 2506

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
478 480 3.569194 TTTGGCTAGGAACACTGACAA 57.431 42.857 0.0 0.0 0.0 3.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1852 1859 1.078143 GCGCAAGATCTGGAACCCT 60.078 57.895 0.3 0.0 43.02 4.34 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
68 69 8.759481 TGGTTAATTATTCTCAATGGCATACA 57.241 30.769 0.00 0.00 0.00 2.29
209 211 9.566432 GATATTCCCTTGTCTACTTTGATTGAT 57.434 33.333 0.00 0.00 0.00 2.57
263 265 7.045126 TGTTGGTAGGAACAATTTTGGTAAG 57.955 36.000 0.00 0.00 32.84 2.34
472 474 5.591877 AGATTGATGATTTGGCTAGGAACAC 59.408 40.000 0.00 0.00 0.00 3.32
476 478 3.674997 TGATTTGGCTAGGAACACTGAC 58.325 45.455 0.00 0.00 0.00 3.51
478 480 3.569194 TTTGGCTAGGAACACTGACAA 57.431 42.857 0.00 0.00 0.00 3.18
489 491 9.273016 CTAGGAACACTGACAAAATTTCTCTTA 57.727 33.333 0.00 0.00 0.00 2.10
701 703 8.893563 TTGATGTGTCCCCTATTAAATCTTTT 57.106 30.769 0.00 0.00 0.00 2.27
926 928 6.642707 TGTATTTCCTTGTTTCAATCCGTT 57.357 33.333 0.00 0.00 0.00 4.44
957 959 8.442632 TTCTCCTCATGCTTATAGTCAAAATG 57.557 34.615 0.00 0.00 0.00 2.32
1139 1141 4.023536 GCTAGTGTTTCCACGATTCCAAAA 60.024 41.667 0.00 0.00 46.56 2.44
1169 1171 3.566322 TGTGATTTGTTAGGTTTCCGTGG 59.434 43.478 0.00 0.00 0.00 4.94
1492 1495 8.798186 AGCCACTTATGGATTGCCTACCAAAT 62.798 42.308 0.00 0.00 44.30 2.32
1561 1564 3.422603 CGTTAAACGATAGCGCTTGTTGT 60.423 43.478 18.68 12.55 46.05 3.32
1677 1681 2.723124 AATTAGCGTTTGTGCCAAGG 57.277 45.000 0.00 0.00 34.65 3.61
1715 1720 4.546674 ACTTGGGGAAAGTCTTGTTGAAT 58.453 39.130 0.00 0.00 46.60 2.57
1741 1748 6.270064 TGCTGTAAAAACAGAAACTTTAGCC 58.730 36.000 9.63 0.00 39.99 3.93
1757 1764 1.004440 GCCCTCACGAGAACTGCTT 60.004 57.895 0.00 0.00 0.00 3.91
1773 1780 8.593492 AGAACTGCTTTCATTTTTATTTGGAC 57.407 30.769 2.10 0.00 36.57 4.02
1925 1932 4.370049 TGACAGATTCCGTTTTTCGTGTA 58.630 39.130 0.00 0.00 37.94 2.90
2197 2207 2.689175 GGATGCCCATGGAACCCA 59.311 61.111 15.22 5.04 38.19 4.51
2385 2397 3.763897 AGTTTACCACAATCATCCTTGCC 59.236 43.478 0.00 0.00 0.00 4.52
2386 2398 3.448093 TTACCACAATCATCCTTGCCA 57.552 42.857 0.00 0.00 0.00 4.92
2424 2436 7.083062 AGAGAGCCATACATGATTTGGAATA 57.917 36.000 14.64 0.00 31.94 1.75
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
68 69 9.959721 TGCACCTTTTTATTAGTAGATCTTTCT 57.040 29.630 0.00 2.88 35.90 2.52
263 265 5.961395 TGAAATTTCCTCTATACGCGTTC 57.039 39.130 20.78 4.15 0.00 3.95
567 569 6.148948 CGGTTATTTCTTTGCACTCATCAAA 58.851 36.000 0.00 0.00 33.04 2.69
658 660 9.593134 ACACATCAATAACTTCTAGATCTTCAC 57.407 33.333 0.00 0.00 0.00 3.18
669 671 8.974060 TTAATAGGGGACACATCAATAACTTC 57.026 34.615 0.00 0.00 0.00 3.01
729 731 5.983333 AAAGGTGGATCATATTCAGTCCT 57.017 39.130 0.00 0.00 0.00 3.85
917 919 6.294361 TGAGGAGAATTTAGAACGGATTGA 57.706 37.500 0.00 0.00 0.00 2.57
926 928 9.147732 TGACTATAAGCATGAGGAGAATTTAGA 57.852 33.333 0.00 0.00 0.00 2.10
957 959 7.669098 TCAACGATATGTTTAGTAAACGCTTC 58.331 34.615 18.49 13.58 44.28 3.86
1100 1102 4.943705 ACACTAGCACCCAAATCACATAAG 59.056 41.667 0.00 0.00 0.00 1.73
1139 1141 7.404671 AAACCTAACAAATCACACAAAGTCT 57.595 32.000 0.00 0.00 0.00 3.24
1169 1171 7.061557 GCAAGTTTAGAGAGCAATCATCAAAAC 59.938 37.037 0.00 0.00 0.00 2.43
1492 1495 8.260818 GCAAGAATAGATCTAGGTATTGCCATA 58.739 37.037 24.61 0.00 37.42 2.74
1561 1564 9.225436 GAATAAAAATAAAATTGGGTTGCCTCA 57.775 29.630 0.00 0.00 0.00 3.86
1623 1626 2.158726 ACAACCAAAACGGAGGCTAGAA 60.159 45.455 0.00 0.00 38.63 2.10
1677 1681 2.143925 CAAGTCTTCCCAACGGTTCTC 58.856 52.381 0.00 0.00 0.00 2.87
1715 1720 7.276878 GGCTAAAGTTTCTGTTTTTACAGCAAA 59.723 33.333 0.00 1.11 37.63 3.68
1741 1748 2.154854 TGAAAGCAGTTCTCGTGAGG 57.845 50.000 0.00 0.00 37.13 3.86
1852 1859 1.078143 GCGCAAGATCTGGAACCCT 60.078 57.895 0.30 0.00 43.02 4.34
1968 1976 9.613428 TGTATTCCAACTTCTCTATGGTTTATG 57.387 33.333 0.00 0.00 35.66 1.90
2197 2207 9.367444 CTTTTACGTGTCCTTAGATTATCTTGT 57.633 33.333 0.00 0.00 0.00 3.16
2385 2397 3.686726 GGCTCTCTCAAAAGGTGTGTATG 59.313 47.826 0.00 0.00 0.00 2.39
2386 2398 3.327757 TGGCTCTCTCAAAAGGTGTGTAT 59.672 43.478 0.00 0.00 0.00 2.29
2424 2436 7.291182 AGGGAAGCACATAGAGTATTCTAACAT 59.709 37.037 0.00 0.00 39.29 2.71


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.