Multiple sequence alignment - TraesCS3A01G269100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G269100 chr3A 100.000 2465 0 0 1 2465 495105837 495103373 0.000000e+00 4553
1 TraesCS3A01G269100 chr3B 98.865 2467 23 3 1 2465 92297809 92295346 0.000000e+00 4396
2 TraesCS3A01G269100 chr3B 98.580 2465 34 1 1 2465 6011843 6009380 0.000000e+00 4357
3 TraesCS3A01G269100 chr2B 98.783 2465 30 0 1 2465 234542237 234539773 0.000000e+00 4386
4 TraesCS3A01G269100 chrUn 98.580 2465 34 1 1 2465 217906591 217909054 0.000000e+00 4357
5 TraesCS3A01G269100 chr4A 98.499 2465 37 0 1 2465 67518421 67520885 0.000000e+00 4348
6 TraesCS3A01G269100 chr4A 92.986 2381 126 18 91 2465 280912075 280909730 0.000000e+00 3434
7 TraesCS3A01G269100 chr4A 93.413 334 19 2 230 561 672531394 672531062 2.200000e-135 492
8 TraesCS3A01G269100 chr4A 98.095 105 2 0 31 135 569955749 569955645 1.510000e-42 183
9 TraesCS3A01G269100 chr4A 94.231 104 6 0 668 771 388429090 388429193 2.540000e-35 159
10 TraesCS3A01G269100 chr4A 85.616 146 16 4 1215 1355 578561545 578561400 5.490000e-32 148
11 TraesCS3A01G269100 chr7A 98.458 2465 38 0 1 2465 563523175 563520711 0.000000e+00 4342
12 TraesCS3A01G269100 chr1B 98.094 2466 46 1 1 2465 619196409 619193944 0.000000e+00 4292


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G269100 chr3A 495103373 495105837 2464 True 4553 4553 100.000 1 2465 1 chr3A.!!$R1 2464
1 TraesCS3A01G269100 chr3B 92295346 92297809 2463 True 4396 4396 98.865 1 2465 1 chr3B.!!$R2 2464
2 TraesCS3A01G269100 chr3B 6009380 6011843 2463 True 4357 4357 98.580 1 2465 1 chr3B.!!$R1 2464
3 TraesCS3A01G269100 chr2B 234539773 234542237 2464 True 4386 4386 98.783 1 2465 1 chr2B.!!$R1 2464
4 TraesCS3A01G269100 chrUn 217906591 217909054 2463 False 4357 4357 98.580 1 2465 1 chrUn.!!$F1 2464
5 TraesCS3A01G269100 chr4A 67518421 67520885 2464 False 4348 4348 98.499 1 2465 1 chr4A.!!$F1 2464
6 TraesCS3A01G269100 chr4A 280909730 280912075 2345 True 3434 3434 92.986 91 2465 1 chr4A.!!$R1 2374
7 TraesCS3A01G269100 chr7A 563520711 563523175 2464 True 4342 4342 98.458 1 2465 1 chr7A.!!$R1 2464
8 TraesCS3A01G269100 chr1B 619193944 619196409 2465 True 4292 4292 98.094 1 2465 1 chr1B.!!$R1 2464

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
899 903 1.084289 GGTGACCTTATTGCACGGTC 58.916 55.0 13.8 13.8 45.76 4.79 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2446 2458 1.99853 CAGCATACCCCAGGTTGGA 59.001 57.895 0.0 0.0 40.96 3.53 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
582 584 3.553922 CGCACTTCTCTTCTTCTTCTGGT 60.554 47.826 0.00 0.00 0.00 4.00
899 903 1.084289 GGTGACCTTATTGCACGGTC 58.916 55.000 13.80 13.80 45.76 4.79
947 951 2.286025 AGTGAACGTGTACGAAAAAGCC 59.714 45.455 11.79 0.00 43.02 4.35
1243 1249 2.056223 GCCAGGATGCATGCCAGTT 61.056 57.895 16.68 0.00 31.97 3.16
1244 1250 1.610554 GCCAGGATGCATGCCAGTTT 61.611 55.000 16.68 0.00 31.97 2.66
1425 1431 1.000060 GCACAGCAAGCAAAGGATTGA 60.000 47.619 0.00 0.00 42.95 2.57
1468 1474 0.532573 AGGTCGTGCGACATGAAGAT 59.467 50.000 23.33 0.95 46.20 2.40
1576 1583 2.957402 TTGTGTGAAGCCTTGGAGAT 57.043 45.000 0.00 0.00 0.00 2.75
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
433 435 1.752694 CCCCCATCGTTTCGCCAAT 60.753 57.895 0.00 0.00 0.00 3.16
582 584 3.003173 CCGGGCAGGAGGTGAAGA 61.003 66.667 0.00 0.00 45.00 2.87
742 745 0.262285 GTGGGGCTCCTAGTCTAGGT 59.738 60.000 22.85 0.00 46.32 3.08
899 903 2.998670 CACATACACAAGTGCTCTCTGG 59.001 50.000 0.00 0.00 0.00 3.86
947 951 3.194317 CGAACAACGAAACTTTACGACG 58.806 45.455 0.00 0.00 45.77 5.12
1243 1249 1.548719 CACTCCACCAGGTCGTATGAA 59.451 52.381 0.00 0.00 35.89 2.57
1244 1250 1.182667 CACTCCACCAGGTCGTATGA 58.817 55.000 0.00 0.00 35.89 2.15
1425 1431 7.016153 TCTTAACATTACACCACTGAATCCT 57.984 36.000 0.00 0.00 0.00 3.24
1468 1474 6.718593 ACTTCCCCCATATTGCTATCAATA 57.281 37.500 1.70 1.70 45.93 1.90
1576 1583 2.440796 CTAGCCCCGGGTACGTCA 60.441 66.667 21.85 1.39 38.78 4.35
2446 2458 1.998530 CAGCATACCCCAGGTTGGA 59.001 57.895 0.00 0.00 40.96 3.53


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.