Multiple sequence alignment - TraesCS3A01G269000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G269000 chr3A 100.000 2192 0 0 1 2192 495104759 495102568 0 4048
1 TraesCS3A01G269000 chr2B 98.540 2192 32 0 1 2192 234541159 234538968 0 3871
2 TraesCS3A01G269000 chr1A 98.449 2192 33 1 1 2192 278521195 278523385 0 3858
3 TraesCS3A01G269000 chrUn 98.221 2192 38 1 1 2192 217907669 217909859 0 3831
4 TraesCS3A01G269000 chr3B 98.221 2192 38 1 1 2192 6010765 6008575 0 3831
5 TraesCS3A01G269000 chr3B 98.222 2194 34 3 1 2192 92296731 92294541 0 3831
6 TraesCS3A01G269000 chr3B 93.003 929 61 4 491 1418 342687462 342688387 0 1352
7 TraesCS3A01G269000 chr1B 98.175 2192 39 1 1 2192 619195330 619193140 0 3825
8 TraesCS3A01G269000 chr7A 97.810 2192 48 0 1 2192 563522097 563519906 0 3783
9 TraesCS3A01G269000 chr7A 98.343 724 12 0 1 724 708280745 708280022 0 1271
10 TraesCS3A01G269000 chr6A 98.700 1923 22 1 1 1923 597252992 597251073 0 3410
11 TraesCS3A01G269000 chr6A 95.374 1124 49 1 1072 2192 413577939 413576816 0 1784


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G269000 chr3A 495102568 495104759 2191 True 4048 4048 100.000 1 2192 1 chr3A.!!$R1 2191
1 TraesCS3A01G269000 chr2B 234538968 234541159 2191 True 3871 3871 98.540 1 2192 1 chr2B.!!$R1 2191
2 TraesCS3A01G269000 chr1A 278521195 278523385 2190 False 3858 3858 98.449 1 2192 1 chr1A.!!$F1 2191
3 TraesCS3A01G269000 chrUn 217907669 217909859 2190 False 3831 3831 98.221 1 2192 1 chrUn.!!$F1 2191
4 TraesCS3A01G269000 chr3B 6008575 6010765 2190 True 3831 3831 98.221 1 2192 1 chr3B.!!$R1 2191
5 TraesCS3A01G269000 chr3B 92294541 92296731 2190 True 3831 3831 98.222 1 2192 1 chr3B.!!$R2 2191
6 TraesCS3A01G269000 chr3B 342687462 342688387 925 False 1352 1352 93.003 491 1418 1 chr3B.!!$F1 927
7 TraesCS3A01G269000 chr1B 619193140 619195330 2190 True 3825 3825 98.175 1 2192 1 chr1B.!!$R1 2191
8 TraesCS3A01G269000 chr7A 563519906 563522097 2191 True 3783 3783 97.810 1 2192 1 chr7A.!!$R1 2191
9 TraesCS3A01G269000 chr7A 708280022 708280745 723 True 1271 1271 98.343 1 724 1 chr7A.!!$R2 723
10 TraesCS3A01G269000 chr6A 597251073 597252992 1919 True 3410 3410 98.700 1 1923 1 chr6A.!!$R2 1922
11 TraesCS3A01G269000 chr6A 413576816 413577939 1123 True 1784 1784 95.374 1072 2192 1 chr6A.!!$R1 1120

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
390 391 0.532573 AGGTCGTGCGACATGAAGAT 59.467 50.0 23.33 0.95 46.2 2.4 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2106 2110 0.179048 CCGTGGATAAGATGGCAGCA 60.179 55.0 5.19 0.0 0.0 4.41 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
347 348 1.000060 GCACAGCAAGCAAAGGATTGA 60.000 47.619 0.00 0.00 42.95 2.57
390 391 0.532573 AGGTCGTGCGACATGAAGAT 59.467 50.000 23.33 0.95 46.20 2.40
498 499 2.957402 TTGTGTGAAGCCTTGGAGAT 57.043 45.000 0.00 0.00 0.00 2.75
1247 1248 3.725490 CATCTGAGAATGATTCGAGCCA 58.275 45.455 0.00 0.00 34.02 4.75
1394 1398 0.986019 TGGGGTATGCTGGGATTCGT 60.986 55.000 0.00 0.00 0.00 3.85
1547 1551 6.486657 GCAATGTCCTAATCAAATGCCTAGTA 59.513 38.462 0.00 0.00 0.00 1.82
1912 1916 1.839994 TGGGAAGCTAGACATCAAGGG 59.160 52.381 0.00 0.00 0.00 3.95
1944 1948 5.422012 TGATGAGGATAACTAAGCTGACACA 59.578 40.000 0.00 0.00 0.00 3.72
2106 2110 3.054802 CCCATTCTTTAGTGAGCTGGAGT 60.055 47.826 0.00 0.00 0.00 3.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
347 348 7.016153 TCTTAACATTACACCACTGAATCCT 57.984 36.000 0.00 0.00 0.00 3.24
390 391 6.718593 ACTTCCCCCATATTGCTATCAATA 57.281 37.500 1.70 1.70 45.93 1.90
498 499 2.440796 CTAGCCCCGGGTACGTCA 60.441 66.667 21.85 1.39 38.78 4.35
1368 1372 1.570857 CCAGCATACCCCAGGTTGGA 61.571 60.000 0.00 0.00 40.96 3.53
1394 1398 0.966179 TCGTAAGGTGCTGCTCTTCA 59.034 50.000 10.93 0.00 38.47 3.02
1547 1551 2.336945 TCATCGGCTTTGATCATGCT 57.663 45.000 17.09 0.13 0.00 3.79
1758 1762 7.556844 AGAAACTGCTCCGAAGAAAGATATTA 58.443 34.615 0.00 0.00 0.00 0.98
1912 1916 3.878778 AGTTATCCTCATCAAGCCACAC 58.121 45.455 0.00 0.00 0.00 3.82
1944 1948 4.335647 CCAGCAGCCAACTCCGGT 62.336 66.667 0.00 0.00 0.00 5.28
2106 2110 0.179048 CCGTGGATAAGATGGCAGCA 60.179 55.000 5.19 0.00 0.00 4.41


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.