Multiple sequence alignment - TraesCS3A01G268900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G268900 chr3A 100.000 2273 0 0 1 2273 495091908 495094180 0 4198
1 TraesCS3A01G268900 chr2B 99.384 2274 13 1 1 2273 449208696 449210969 0 4120
2 TraesCS3A01G268900 chr2B 99.076 2273 21 0 1 2273 234530528 234532800 0 4082
3 TraesCS3A01G268900 chr3B 99.120 2274 19 1 1 2273 6000134 6002407 0 4087
4 TraesCS3A01G268900 chr7A 99.032 2273 22 0 1 2273 60220133 60222405 0 4076
5 TraesCS3A01G268900 chr4B 98.768 2273 28 0 1 2273 495577615 495579887 0 4043
6 TraesCS3A01G268900 chr1B 98.504 2273 34 0 1 2273 619184699 619186971 0 4010
7 TraesCS3A01G268900 chr6B 97.758 2275 48 2 1 2273 625612107 625614380 0 3916


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G268900 chr3A 495091908 495094180 2272 False 4198 4198 100.000 1 2273 1 chr3A.!!$F1 2272
1 TraesCS3A01G268900 chr2B 449208696 449210969 2273 False 4120 4120 99.384 1 2273 1 chr2B.!!$F2 2272
2 TraesCS3A01G268900 chr2B 234530528 234532800 2272 False 4082 4082 99.076 1 2273 1 chr2B.!!$F1 2272
3 TraesCS3A01G268900 chr3B 6000134 6002407 2273 False 4087 4087 99.120 1 2273 1 chr3B.!!$F1 2272
4 TraesCS3A01G268900 chr7A 60220133 60222405 2272 False 4076 4076 99.032 1 2273 1 chr7A.!!$F1 2272
5 TraesCS3A01G268900 chr4B 495577615 495579887 2272 False 4043 4043 98.768 1 2273 1 chr4B.!!$F1 2272
6 TraesCS3A01G268900 chr1B 619184699 619186971 2272 False 4010 4010 98.504 1 2273 1 chr1B.!!$F1 2272
7 TraesCS3A01G268900 chr6B 625612107 625614380 2273 False 3916 3916 97.758 1 2273 1 chr6B.!!$F1 2272

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
909 913 1.240527 AGGCTCTCCCTGGACTCTAT 58.759 55.0 0.0 0.0 44.28 1.98 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2047 2051 2.36212 GTGGATGGCAAGCAGGCT 60.362 61.111 0.0 0.0 44.55 4.58 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
177 178 4.806952 CCCTAGGTTGGGGATAATGAAA 57.193 45.455 8.29 0.0 46.50 2.69
909 913 1.240527 AGGCTCTCCCTGGACTCTAT 58.759 55.000 0.00 0.0 44.28 1.98
1460 1464 6.823182 TCCAATTTCTCGATTCAATAGAAGCA 59.177 34.615 0.00 0.0 40.09 3.91
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
177 178 5.393461 GCATCTCCCAACAAGATTCGAAAAT 60.393 40.000 0.00 0.00 31.05 1.82
297 298 1.593787 CGTCCTCACAGTCAGCCAT 59.406 57.895 0.00 0.00 0.00 4.40
909 913 2.639839 AGGCTTAGAAAGAAGTCCTGCA 59.360 45.455 0.00 0.00 34.03 4.41
1460 1464 3.886123 GGTACCATATGCACCTCTTTGT 58.114 45.455 7.15 0.48 0.00 2.83
2047 2051 2.362120 GTGGATGGCAAGCAGGCT 60.362 61.111 0.00 0.00 44.55 4.58


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.