Multiple sequence alignment - TraesCS3A01G234200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G234200 chr3A 100.000 2634 0 0 1 2634 437676171 437678804 0 4865
1 TraesCS3A01G234200 chr3A 97.837 2635 55 2 1 2634 542160868 542163501 0 4549
2 TraesCS3A01G234200 chr3A 96.170 2637 90 9 1 2634 285835992 285833364 0 4300
3 TraesCS3A01G234200 chr3A 99.884 865 1 0 1 865 437759893 437760757 0 1592
4 TraesCS3A01G234200 chr7A 97.610 2636 61 2 1 2634 193099954 193097319 0 4518
5 TraesCS3A01G234200 chr7A 95.778 1137 48 0 1498 2634 184698613 184699749 0 1834
6 TraesCS3A01G234200 chr7A 93.670 932 36 4 1 929 184662138 184663049 0 1373
7 TraesCS3A01G234200 chr7A 93.610 579 35 2 925 1502 184693739 184694316 0 863
8 TraesCS3A01G234200 chr1B 93.601 2641 148 14 1 2634 149513817 149511191 0 3921
9 TraesCS3A01G234200 chr1A 93.376 2642 161 12 1 2634 107536320 107538955 0 3897
10 TraesCS3A01G234200 chr6D 92.058 2279 172 6 362 2634 239952570 239954845 0 3197
11 TraesCS3A01G234200 chr4D 96.270 1850 57 4 794 2634 304269333 304271179 0 3024
12 TraesCS3A01G234200 chr4D 97.244 762 18 2 1 759 304268573 304269334 0 1288
13 TraesCS3A01G234200 chr2D 85.472 1418 192 12 869 2278 225260952 225262363 0 1465
14 TraesCS3A01G234200 chr3B 87.740 1093 130 3 1236 2328 262072638 262071550 0 1273
15 TraesCS3A01G234200 chr2A 93.176 762 32 6 1 759 398328868 398329612 0 1101
16 TraesCS3A01G234200 chr6A 90.634 662 56 4 362 1019 342547958 342548617 0 874


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G234200 chr3A 437676171 437678804 2633 False 4865 4865 100.000 1 2634 1 chr3A.!!$F1 2633
1 TraesCS3A01G234200 chr3A 542160868 542163501 2633 False 4549 4549 97.837 1 2634 1 chr3A.!!$F3 2633
2 TraesCS3A01G234200 chr3A 285833364 285835992 2628 True 4300 4300 96.170 1 2634 1 chr3A.!!$R1 2633
3 TraesCS3A01G234200 chr3A 437759893 437760757 864 False 1592 1592 99.884 1 865 1 chr3A.!!$F2 864
4 TraesCS3A01G234200 chr7A 193097319 193099954 2635 True 4518 4518 97.610 1 2634 1 chr7A.!!$R1 2633
5 TraesCS3A01G234200 chr7A 184698613 184699749 1136 False 1834 1834 95.778 1498 2634 1 chr7A.!!$F3 1136
6 TraesCS3A01G234200 chr7A 184662138 184663049 911 False 1373 1373 93.670 1 929 1 chr7A.!!$F1 928
7 TraesCS3A01G234200 chr7A 184693739 184694316 577 False 863 863 93.610 925 1502 1 chr7A.!!$F2 577
8 TraesCS3A01G234200 chr1B 149511191 149513817 2626 True 3921 3921 93.601 1 2634 1 chr1B.!!$R1 2633
9 TraesCS3A01G234200 chr1A 107536320 107538955 2635 False 3897 3897 93.376 1 2634 1 chr1A.!!$F1 2633
10 TraesCS3A01G234200 chr6D 239952570 239954845 2275 False 3197 3197 92.058 362 2634 1 chr6D.!!$F1 2272
11 TraesCS3A01G234200 chr4D 304268573 304271179 2606 False 2156 3024 96.757 1 2634 2 chr4D.!!$F1 2633
12 TraesCS3A01G234200 chr2D 225260952 225262363 1411 False 1465 1465 85.472 869 2278 1 chr2D.!!$F1 1409
13 TraesCS3A01G234200 chr3B 262071550 262072638 1088 True 1273 1273 87.740 1236 2328 1 chr3B.!!$R1 1092
14 TraesCS3A01G234200 chr2A 398328868 398329612 744 False 1101 1101 93.176 1 759 1 chr2A.!!$F1 758
15 TraesCS3A01G234200 chr6A 342547958 342548617 659 False 874 874 90.634 362 1019 1 chr6A.!!$F1 657

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
952 965 4.402155 TCTCTGTTTTGCAGGTTGTTTCAT 59.598 37.5 0.0 0.0 45.08 2.57 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2183 2210 5.934402 ATAAACCCAAGATCTACAGACGT 57.066 39.13 0.0 0.0 0.0 4.34 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
952 965 4.402155 TCTCTGTTTTGCAGGTTGTTTCAT 59.598 37.500 0.0 0.0 45.08 2.57
1142 1156 2.063266 GTGTGCGTCGGTATTTTCTCA 58.937 47.619 0.0 0.0 0.00 3.27
2036 2063 1.974236 CTGGTTCCCTGTTCTCACTCT 59.026 52.381 0.0 0.0 0.00 3.24
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
887 900 2.613133 CAACAAAGGCAACACCCAAATG 59.387 45.455 0.00 0.00 40.58 2.32
952 965 5.450137 CGGCTCGAAGAAATAACCTCTAGAA 60.450 44.000 0.00 0.00 34.09 2.10
1142 1156 9.787435 TGTAGTAATGACACATTAAGGAAAACT 57.213 29.630 5.89 3.43 0.00 2.66
2183 2210 5.934402 ATAAACCCAAGATCTACAGACGT 57.066 39.130 0.00 0.00 0.00 4.34


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.