Multiple sequence alignment - TraesCS3A01G206700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G206700 chr3A 100.000 2744 0 0 1 2744 363955884 363958627 0.000000e+00 5068.0
1 TraesCS3A01G206700 chr4A 99.708 2744 7 1 1 2744 95159799 95162541 0.000000e+00 5022.0
2 TraesCS3A01G206700 chr4A 87.493 1919 208 16 1 1915 13438745 13440635 0.000000e+00 2185.0
3 TraesCS3A01G206700 chr4A 85.635 181 16 7 1918 2088 13440666 13440846 6.040000e-42 182.0
4 TraesCS3A01G206700 chr4A 91.111 45 2 2 2597 2640 716383806 716383849 2.950000e-05 60.2
5 TraesCS3A01G206700 chr7A 99.256 2151 10 1 1 2151 238534127 238531983 0.000000e+00 3879.0
6 TraesCS3A01G206700 chr7A 91.045 268 23 1 2165 2432 401822105 401821839 7.220000e-96 361.0
7 TraesCS3A01G206700 chr7D 94.027 2143 115 5 1 2133 529732546 529734685 0.000000e+00 3236.0
8 TraesCS3A01G206700 chr7D 90.545 275 21 3 2159 2432 415928329 415928599 2.600000e-95 359.0
9 TraesCS3A01G206700 chr7D 93.023 43 2 1 2594 2636 13925190 13925231 8.200000e-06 62.1
10 TraesCS3A01G206700 chr7D 100.000 31 0 0 2555 2585 529735020 529735050 1.060000e-04 58.4
11 TraesCS3A01G206700 chr7D 100.000 31 0 0 2555 2585 529735326 529735356 1.060000e-04 58.4
12 TraesCS3A01G206700 chrUn 99.738 1529 4 0 23 1551 391828703 391830231 0.000000e+00 2802.0
13 TraesCS3A01G206700 chrUn 92.857 42 1 2 2608 2648 382216079 382216119 2.950000e-05 60.2
14 TraesCS3A01G206700 chr2A 86.711 2122 224 21 1 2088 344887294 344889391 0.000000e+00 2303.0
15 TraesCS3A01G206700 chr2A 86.704 2121 221 22 1 2088 345158895 345160987 0.000000e+00 2298.0
16 TraesCS3A01G206700 chr2A 86.270 2134 221 26 1 2088 348216257 348218364 0.000000e+00 2252.0
17 TraesCS3A01G206700 chr2B 87.546 1919 207 16 1 1915 784693856 784695746 0.000000e+00 2191.0
18 TraesCS3A01G206700 chr2B 85.635 181 16 7 1918 2088 784695777 784695957 6.040000e-42 182.0
19 TraesCS3A01G206700 chr2B 93.750 64 1 3 2584 2646 795476734 795476795 2.910000e-15 93.5
20 TraesCS3A01G206700 chr6B 88.738 1767 176 15 1 1757 25746173 25747926 0.000000e+00 2139.0
21 TraesCS3A01G206700 chr6B 91.321 265 13 2 1912 2167 25748277 25748540 1.210000e-93 353.0
22 TraesCS3A01G206700 chr6B 92.500 160 8 1 2430 2585 25748539 25748698 2.750000e-55 226.0
23 TraesCS3A01G206700 chr6B 98.113 53 1 0 2584 2636 529898794 529898846 2.910000e-15 93.5
24 TraesCS3A01G206700 chr5D 94.620 1078 45 4 1102 2167 542147847 542148923 0.000000e+00 1657.0
25 TraesCS3A01G206700 chr5D 91.250 160 9 2 2430 2585 542148922 542149080 2.140000e-51 213.0
26 TraesCS3A01G206700 chr7B 92.164 268 21 0 2165 2432 23602796 23602529 1.990000e-101 379.0
27 TraesCS3A01G206700 chr5B 92.509 267 17 1 2163 2429 283780558 283780821 1.990000e-101 379.0
28 TraesCS3A01G206700 chr5B 90.809 272 23 2 2161 2432 556344687 556344418 2.010000e-96 363.0
29 TraesCS3A01G206700 chr5B 100.000 34 0 0 2711 2744 165162035 165162068 2.280000e-06 63.9
30 TraesCS3A01G206700 chr5B 95.122 41 1 1 2597 2637 237809067 237809028 2.280000e-06 63.9
31 TraesCS3A01G206700 chr3D 90.511 274 20 4 2160 2432 515251042 515251310 9.340000e-95 357.0
32 TraesCS3A01G206700 chr3B 90.253 277 22 2 2166 2441 251867121 251867393 9.340000e-95 357.0
33 TraesCS3A01G206700 chr3B 98.113 53 1 0 2584 2636 732835933 732835985 2.910000e-15 93.5
34 TraesCS3A01G206700 chr3B 97.059 34 1 0 2711 2744 428756949 428756916 1.060000e-04 58.4
35 TraesCS3A01G206700 chr6A 90.182 275 23 3 2160 2433 105506429 105506700 3.360000e-94 355.0
36 TraesCS3A01G206700 chr1A 88.073 109 12 1 1915 2023 107523788 107523681 7.980000e-26 128.0
37 TraesCS3A01G206700 chr1A 88.073 109 12 1 1915 2023 111976263 111976156 7.980000e-26 128.0
38 TraesCS3A01G206700 chr1A 96.491 57 1 1 2584 2640 563778505 563778450 2.910000e-15 93.5
39 TraesCS3A01G206700 chr1B 100.000 34 0 0 2711 2744 83750376 83750343 2.280000e-06 63.9
40 TraesCS3A01G206700 chr1B 100.000 34 0 0 2711 2744 268805182 268805215 2.280000e-06 63.9


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G206700 chr3A 363955884 363958627 2743 False 5068.0 5068 100.0000 1 2744 1 chr3A.!!$F1 2743
1 TraesCS3A01G206700 chr4A 95159799 95162541 2742 False 5022.0 5022 99.7080 1 2744 1 chr4A.!!$F1 2743
2 TraesCS3A01G206700 chr4A 13438745 13440846 2101 False 1183.5 2185 86.5640 1 2088 2 chr4A.!!$F3 2087
3 TraesCS3A01G206700 chr7A 238531983 238534127 2144 True 3879.0 3879 99.2560 1 2151 1 chr7A.!!$R1 2150
4 TraesCS3A01G206700 chr7D 529732546 529735356 2810 False 1117.6 3236 98.0090 1 2585 3 chr7D.!!$F3 2584
5 TraesCS3A01G206700 chrUn 391828703 391830231 1528 False 2802.0 2802 99.7380 23 1551 1 chrUn.!!$F2 1528
6 TraesCS3A01G206700 chr2A 344887294 344889391 2097 False 2303.0 2303 86.7110 1 2088 1 chr2A.!!$F1 2087
7 TraesCS3A01G206700 chr2A 345158895 345160987 2092 False 2298.0 2298 86.7040 1 2088 1 chr2A.!!$F2 2087
8 TraesCS3A01G206700 chr2A 348216257 348218364 2107 False 2252.0 2252 86.2700 1 2088 1 chr2A.!!$F3 2087
9 TraesCS3A01G206700 chr2B 784693856 784695957 2101 False 1186.5 2191 86.5905 1 2088 2 chr2B.!!$F2 2087
10 TraesCS3A01G206700 chr6B 25746173 25748698 2525 False 906.0 2139 90.8530 1 2585 3 chr6B.!!$F2 2584
11 TraesCS3A01G206700 chr5D 542147847 542149080 1233 False 935.0 1657 92.9350 1102 2585 2 chr5D.!!$F1 1483

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1147 1162 7.054124 TCTATTCACATTGGACAAAGATACCC 58.946 38.462 0.0 0.0 0.0 3.69 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2207 2502 6.319658 TCTCCACATGCATTCTTTAATCTTCC 59.68 38.462 0.0 0.0 0.0 3.46 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1147 1162 7.054124 TCTATTCACATTGGACAAAGATACCC 58.946 38.462 0.0 0.0 0.00 3.69
1684 1717 7.039504 ACAATGAAAGTGAAGATAACATGCCTT 60.040 33.333 0.0 0.0 34.17 4.35
2033 2315 7.194112 TCTTGATGGTGGTCTTATGTATTGA 57.806 36.000 0.0 0.0 0.00 2.57
2207 2502 2.306847 AGGGTGTACAGTTTTTGGCAG 58.693 47.619 0.0 0.0 0.00 4.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
302 306 3.067106 CAACGATTGTAGTCCTTGCTGT 58.933 45.455 0.00 0.00 0.00 4.40
1147 1162 3.058501 GGGTCCAAAATGTACACAGTTCG 60.059 47.826 0.00 0.00 32.55 3.95
1684 1717 4.545208 TGATGAATTCAAGTACACCGGA 57.455 40.909 13.09 0.00 0.00 5.14
2033 2315 8.286800 CACTGCAAAACATCATGAAATTTCAAT 58.713 29.630 23.91 11.75 41.13 2.57
2207 2502 6.319658 TCTCCACATGCATTCTTTAATCTTCC 59.680 38.462 0.00 0.00 0.00 3.46


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.