Multiple sequence alignment - TraesCS3A01G200700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G200700 chr3A 100.000 3183 0 0 738 3920 332221535 332224717 0.000000e+00 5879
1 TraesCS3A01G200700 chr3A 100.000 460 0 0 1 460 332220798 332221257 0.000000e+00 850
2 TraesCS3A01G200700 chr5B 98.806 3183 38 0 738 3920 437770655 437767473 0.000000e+00 5668
3 TraesCS3A01G200700 chr5B 96.739 460 15 0 1 460 437771198 437770739 0.000000e+00 767
4 TraesCS3A01G200700 chr2B 92.716 3199 212 9 740 3919 675366383 675363187 0.000000e+00 4597
5 TraesCS3A01G200700 chr2B 87.902 3199 365 9 740 3919 704814335 704817530 0.000000e+00 3744
6 TraesCS3A01G200700 chr2B 87.746 3199 371 8 740 3919 262528084 262524888 0.000000e+00 3716
7 TraesCS3A01G200700 chr2B 81.843 3244 511 41 745 3919 577245811 577249045 0.000000e+00 2656
8 TraesCS3A01G200700 chr2B 87.939 1252 140 5 743 1984 412057093 412055843 0.000000e+00 1465
9 TraesCS3A01G200700 chr2B 89.641 473 33 10 4 460 675366937 675366465 4.360000e-164 588
10 TraesCS3A01G200700 chr2B 84.728 478 46 16 4 460 262528638 262528167 1.660000e-123 453
11 TraesCS3A01G200700 chr2B 81.984 494 46 20 4 460 412057666 412057179 2.860000e-101 379
12 TraesCS3A01G200700 chr3B 92.623 3199 215 9 740 3919 605004730 605007926 0.000000e+00 4580
13 TraesCS3A01G200700 chr3B 87.610 2833 312 10 976 3771 162623912 162626742 0.000000e+00 3251
14 TraesCS3A01G200700 chr3B 89.852 473 32 10 4 460 605004175 605004647 9.380000e-166 593
15 TraesCS3A01G200700 chr1A 91.779 2676 198 10 1263 3919 25581849 25579177 0.000000e+00 3703
16 TraesCS3A01G200700 chr7B 83.179 3240 475 37 743 3919 368143203 368139971 0.000000e+00 2900
17 TraesCS3A01G200700 chr7B 82.008 478 59 16 4 460 368143760 368143289 7.950000e-102 381
18 TraesCS3A01G200700 chr7B 86.932 176 18 5 287 460 697174010 697173838 4.000000e-45 193
19 TraesCS3A01G200700 chr2A 97.547 1427 34 1 2494 3920 140209325 140210750 0.000000e+00 2440
20 TraesCS3A01G200700 chr6D 78.502 307 50 11 168 460 159862060 159862364 1.860000e-43 187
21 TraesCS3A01G200700 chr5D 74.636 481 77 27 16 460 340957669 340957198 1.870000e-38 171


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G200700 chr3A 332220798 332224717 3919 False 3364.5 5879 100.0000 1 3920 2 chr3A.!!$F1 3919
1 TraesCS3A01G200700 chr5B 437767473 437771198 3725 True 3217.5 5668 97.7725 1 3920 2 chr5B.!!$R1 3919
2 TraesCS3A01G200700 chr2B 704814335 704817530 3195 False 3744.0 3744 87.9020 740 3919 1 chr2B.!!$F2 3179
3 TraesCS3A01G200700 chr2B 577245811 577249045 3234 False 2656.0 2656 81.8430 745 3919 1 chr2B.!!$F1 3174
4 TraesCS3A01G200700 chr2B 675363187 675366937 3750 True 2592.5 4597 91.1785 4 3919 2 chr2B.!!$R3 3915
5 TraesCS3A01G200700 chr2B 262524888 262528638 3750 True 2084.5 3716 86.2370 4 3919 2 chr2B.!!$R1 3915
6 TraesCS3A01G200700 chr2B 412055843 412057666 1823 True 922.0 1465 84.9615 4 1984 2 chr2B.!!$R2 1980
7 TraesCS3A01G200700 chr3B 162623912 162626742 2830 False 3251.0 3251 87.6100 976 3771 1 chr3B.!!$F1 2795
8 TraesCS3A01G200700 chr3B 605004175 605007926 3751 False 2586.5 4580 91.2375 4 3919 2 chr3B.!!$F2 3915
9 TraesCS3A01G200700 chr1A 25579177 25581849 2672 True 3703.0 3703 91.7790 1263 3919 1 chr1A.!!$R1 2656
10 TraesCS3A01G200700 chr7B 368139971 368143760 3789 True 1640.5 2900 82.5935 4 3919 2 chr7B.!!$R2 3915
11 TraesCS3A01G200700 chr2A 140209325 140210750 1425 False 2440.0 2440 97.5470 2494 3920 1 chr2A.!!$F1 1426

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
130 136 1.203313 TCTAGGTCTGGTGCTTTCCCT 60.203 52.381 0.00 0.0 0.0 4.20 F
939 976 2.515398 CCTGTGGGGTCTGTGCAA 59.485 61.111 0.00 0.0 0.0 4.08 F
2104 2181 2.167900 ACTGTACCGGTGGATAAAGCTC 59.832 50.000 19.93 0.0 0.0 4.09 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1944 2021 1.247567 CCGGATTTTCTGTGGCACTT 58.752 50.0 19.83 0.0 0.0 3.16 R
2528 2644 0.108472 CAGTGCAGCGATCTCCTTGA 60.108 55.0 0.00 0.0 0.0 3.02 R
3609 3728 0.823356 GGACAGGGCTTGCAACAAGA 60.823 55.0 11.38 0.0 0.0 3.02 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
130 136 1.203313 TCTAGGTCTGGTGCTTTCCCT 60.203 52.381 0.00 0.00 0.00 4.20
939 976 2.515398 CCTGTGGGGTCTGTGCAA 59.485 61.111 0.00 0.00 0.00 4.08
2104 2181 2.167900 ACTGTACCGGTGGATAAAGCTC 59.832 50.000 19.93 0.00 0.00 4.09
2216 2293 2.721167 CCAATCAGGGCGAGTCGGA 61.721 63.158 15.52 2.97 0.00 4.55
2528 2644 1.202891 CCAGGAAGGAAACCTTTCGGT 60.203 52.381 4.51 0.00 44.82 4.69
2820 2936 1.601903 GTGTTCGATTCACCACTGCAA 59.398 47.619 9.25 0.00 0.00 4.08
3017 3136 0.323629 CAGAGGCCTTAACAACCCGA 59.676 55.000 6.77 0.00 0.00 5.14
3467 3586 4.958581 GGAGAATGATGGGGAAATTCAAGT 59.041 41.667 0.00 0.00 33.61 3.16
3609 3728 2.907042 GGGAGATAGATCACCCGGATTT 59.093 50.000 0.73 0.00 45.56 2.17
3777 3896 2.774687 GGTTTGCGACCCCGATATTAT 58.225 47.619 0.00 0.00 43.06 1.28
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
130 136 1.213013 GGCAAGAGACGAGAAGCGA 59.787 57.895 0.00 0.0 44.57 4.93
1944 2021 1.247567 CCGGATTTTCTGTGGCACTT 58.752 50.000 19.83 0.0 0.00 3.16
2104 2181 1.272092 TGGTGAAATTGCCTCCTCTGG 60.272 52.381 0.00 0.0 0.00 3.86
2216 2293 1.619363 TGGGCCACCTCTATGCCTT 60.619 57.895 0.00 0.0 44.71 4.35
2528 2644 0.108472 CAGTGCAGCGATCTCCTTGA 60.108 55.000 0.00 0.0 0.00 3.02
3467 3586 1.192757 CGCGTTGTTATCCACGAAACA 59.807 47.619 0.00 0.0 33.92 2.83
3609 3728 0.823356 GGACAGGGCTTGCAACAAGA 60.823 55.000 11.38 0.0 0.00 3.02
3777 3896 2.986019 TCCAACCTCAAGAAAGGATCCA 59.014 45.455 15.82 0.0 38.87 3.41


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.