Multiple sequence alignment - TraesCS3A01G190500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G190500 chr3A 100.000 4607 0 0 1 4607 237060138 237055532 0.000000e+00 8508.0
1 TraesCS3A01G190500 chr3A 98.624 3996 40 3 15 3995 69954989 69950994 0.000000e+00 7060.0
2 TraesCS3A01G190500 chr3A 92.576 687 12 8 3922 4607 69951110 69950462 0.000000e+00 950.0
3 TraesCS3A01G190500 chr3A 92.997 357 14 2 4262 4607 44771486 44771842 1.140000e-140 510.0
4 TraesCS3A01G190500 chr3A 92.560 336 12 7 4281 4606 22601093 22601425 1.940000e-128 470.0
5 TraesCS3A01G190500 chr3A 89.888 356 21 5 4262 4606 145555819 145556170 1.180000e-120 444.0
6 TraesCS3A01G190500 chr3A 91.018 334 20 1 4284 4607 635315175 635314842 4.230000e-120 442.0
7 TraesCS3A01G190500 chr3A 95.565 248 1 1 14 251 69945358 69945605 5.590000e-104 388.0
8 TraesCS3A01G190500 chr3A 94.595 37 1 1 4262 4297 145555785 145555821 6.440000e-04 56.5
9 TraesCS3A01G190500 chr2B 98.679 4618 34 5 15 4607 364330660 364335275 0.000000e+00 8165.0
10 TraesCS3A01G190500 chr2B 98.221 4610 50 6 14 4607 770078140 770082733 0.000000e+00 8030.0
11 TraesCS3A01G190500 chr1B 98.506 4618 30 6 15 4607 302765056 302769659 0.000000e+00 8109.0
12 TraesCS3A01G190500 chr1B 98.568 3772 28 4 15 3761 443572058 443568288 0.000000e+00 6643.0
13 TraesCS3A01G190500 chr5B 98.375 4616 36 9 18 4607 436483934 436479332 0.000000e+00 8072.0
14 TraesCS3A01G190500 chr5B 98.844 4240 33 3 383 4607 281825796 281830034 0.000000e+00 7544.0
15 TraesCS3A01G190500 chr5B 98.607 3660 42 3 948 4607 351463267 351466917 0.000000e+00 6468.0
16 TraesCS3A01G190500 chr5B 96.947 524 4 3 15 526 471287361 471287884 0.000000e+00 869.0
17 TraesCS3A01G190500 chr4A 98.393 4605 47 7 15 4607 735300107 735295518 0.000000e+00 8069.0
18 TraesCS3A01G190500 chr7A 97.988 4622 47 6 15 4607 16012312 16007708 0.000000e+00 7978.0
19 TraesCS3A01G190500 chr7A 96.947 524 4 3 15 526 121915369 121915892 0.000000e+00 869.0
20 TraesCS3A01G190500 chr7A 95.565 248 1 1 14 251 16002044 16002291 5.590000e-104 388.0
21 TraesCS3A01G190500 chr2A 97.946 4624 50 6 14 4607 148608100 148612708 0.000000e+00 7971.0
22 TraesCS3A01G190500 chr2A 97.945 4622 49 7 15 4607 728941090 728936486 0.000000e+00 7967.0
23 TraesCS3A01G190500 chr3B 97.407 4628 52 10 15 4607 798605217 798609811 0.000000e+00 7819.0
24 TraesCS3A01G190500 chr6A 98.071 4252 47 5 376 4607 466685838 466681602 0.000000e+00 7365.0
25 TraesCS3A01G190500 chr6A 96.939 392 2 1 15 396 466687671 466687280 0.000000e+00 649.0
26 TraesCS3A01G190500 chr5A 98.344 3864 56 3 747 4607 591480243 591476385 0.000000e+00 6774.0
27 TraesCS3A01G190500 chr5A 96.870 607 6 4 15 610 300954790 300955394 0.000000e+00 1003.0
28 TraesCS3A01G190500 chr7B 95.399 4282 99 41 368 4607 707565975 707570200 0.000000e+00 6726.0
29 TraesCS3A01G190500 chr7B 97.160 3909 57 9 747 4607 577217904 577214002 0.000000e+00 6554.0
30 TraesCS3A01G190500 chr7B 90.835 4681 277 92 15 4607 130341256 130336640 0.000000e+00 6128.0
31 TraesCS3A01G190500 chr7B 94.906 3828 113 38 805 4607 707623135 707619365 0.000000e+00 5914.0
32 TraesCS3A01G190500 chr7B 97.561 1804 16 6 14 1790 102657693 102655891 0.000000e+00 3062.0
33 TraesCS3A01G190500 chr7B 99.485 583 3 0 4025 4607 102655891 102655309 0.000000e+00 1061.0
34 TraesCS3A01G190500 chr7B 84.510 878 59 49 3766 4607 335930633 335929797 0.000000e+00 797.0
35 TraesCS3A01G190500 chr7B 97.368 114 1 2 4184 4295 713540960 713541073 4.700000e-45 193.0
36 TraesCS3A01G190500 chr7B 96.491 114 2 2 4184 4295 687043762 687043649 2.190000e-43 187.0
37 TraesCS3A01G190500 chr7B 94.737 114 4 2 4184 4295 95038824 95038937 4.740000e-40 176.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G190500 chr3A 237055532 237060138 4606 True 8508.0 8508 100.000 1 4607 1 chr3A.!!$R1 4606
1 TraesCS3A01G190500 chr3A 69950462 69954989 4527 True 4005.0 7060 95.600 15 4607 2 chr3A.!!$R3 4592
2 TraesCS3A01G190500 chr2B 364330660 364335275 4615 False 8165.0 8165 98.679 15 4607 1 chr2B.!!$F1 4592
3 TraesCS3A01G190500 chr2B 770078140 770082733 4593 False 8030.0 8030 98.221 14 4607 1 chr2B.!!$F2 4593
4 TraesCS3A01G190500 chr1B 302765056 302769659 4603 False 8109.0 8109 98.506 15 4607 1 chr1B.!!$F1 4592
5 TraesCS3A01G190500 chr1B 443568288 443572058 3770 True 6643.0 6643 98.568 15 3761 1 chr1B.!!$R1 3746
6 TraesCS3A01G190500 chr5B 436479332 436483934 4602 True 8072.0 8072 98.375 18 4607 1 chr5B.!!$R1 4589
7 TraesCS3A01G190500 chr5B 281825796 281830034 4238 False 7544.0 7544 98.844 383 4607 1 chr5B.!!$F1 4224
8 TraesCS3A01G190500 chr5B 351463267 351466917 3650 False 6468.0 6468 98.607 948 4607 1 chr5B.!!$F2 3659
9 TraesCS3A01G190500 chr5B 471287361 471287884 523 False 869.0 869 96.947 15 526 1 chr5B.!!$F3 511
10 TraesCS3A01G190500 chr4A 735295518 735300107 4589 True 8069.0 8069 98.393 15 4607 1 chr4A.!!$R1 4592
11 TraesCS3A01G190500 chr7A 16007708 16012312 4604 True 7978.0 7978 97.988 15 4607 1 chr7A.!!$R1 4592
12 TraesCS3A01G190500 chr7A 121915369 121915892 523 False 869.0 869 96.947 15 526 1 chr7A.!!$F2 511
13 TraesCS3A01G190500 chr2A 148608100 148612708 4608 False 7971.0 7971 97.946 14 4607 1 chr2A.!!$F1 4593
14 TraesCS3A01G190500 chr2A 728936486 728941090 4604 True 7967.0 7967 97.945 15 4607 1 chr2A.!!$R1 4592
15 TraesCS3A01G190500 chr3B 798605217 798609811 4594 False 7819.0 7819 97.407 15 4607 1 chr3B.!!$F1 4592
16 TraesCS3A01G190500 chr6A 466681602 466687671 6069 True 4007.0 7365 97.505 15 4607 2 chr6A.!!$R1 4592
17 TraesCS3A01G190500 chr5A 591476385 591480243 3858 True 6774.0 6774 98.344 747 4607 1 chr5A.!!$R1 3860
18 TraesCS3A01G190500 chr5A 300954790 300955394 604 False 1003.0 1003 96.870 15 610 1 chr5A.!!$F1 595
19 TraesCS3A01G190500 chr7B 707565975 707570200 4225 False 6726.0 6726 95.399 368 4607 1 chr7B.!!$F2 4239
20 TraesCS3A01G190500 chr7B 577214002 577217904 3902 True 6554.0 6554 97.160 747 4607 1 chr7B.!!$R3 3860
21 TraesCS3A01G190500 chr7B 130336640 130341256 4616 True 6128.0 6128 90.835 15 4607 1 chr7B.!!$R1 4592
22 TraesCS3A01G190500 chr7B 707619365 707623135 3770 True 5914.0 5914 94.906 805 4607 1 chr7B.!!$R5 3802
23 TraesCS3A01G190500 chr7B 102655309 102657693 2384 True 2061.5 3062 98.523 14 4607 2 chr7B.!!$R6 4593
24 TraesCS3A01G190500 chr7B 335929797 335930633 836 True 797.0 797 84.510 3766 4607 1 chr7B.!!$R2 841

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
386 402 3.138283 TCAACCCCTCAAACTCACAGATT 59.862 43.478 0.0 0.0 0.00 2.40 F
1343 2959 2.682136 TGGATCGTTGGAGGCCGA 60.682 61.111 0.0 0.0 37.51 5.54 F
1603 3219 0.178970 GCCCTCAGGATGCCAATGAT 60.179 55.000 0.0 0.0 34.76 2.45 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1603 3219 1.157257 CGTACTGCTGCACAACCACA 61.157 55.0 0.0 0.0 0.00 4.17 R
3396 5017 0.544833 TACCTTTCTGGCCCGGTGTA 60.545 55.0 0.0 0.0 40.22 2.90 R
3951 5654 1.045407 TTGGTCGCCTGACTTACAGT 58.955 50.0 0.0 0.0 44.83 3.55 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
386 402 3.138283 TCAACCCCTCAAACTCACAGATT 59.862 43.478 0.00 0.00 0.00 2.40
1343 2959 2.682136 TGGATCGTTGGAGGCCGA 60.682 61.111 0.00 0.00 37.51 5.54
1603 3219 0.178970 GCCCTCAGGATGCCAATGAT 60.179 55.000 0.00 0.00 34.76 2.45
1718 3334 5.007682 TGTTCTTGGAGCCACTTAATAACC 58.992 41.667 0.00 0.00 0.00 2.85
3951 5654 2.203788 AGGGTCCTTGGCGTCTGA 60.204 61.111 0.00 0.00 0.00 3.27
3994 5697 3.637273 GGGTCCTTGGCGTCTGGT 61.637 66.667 0.00 0.00 0.00 4.00
4360 6253 5.416083 TCACATATAACTCGGTTTCCTGTG 58.584 41.667 13.08 13.08 32.91 3.66
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
0 1 1.878953 TTGTCCGTTCTTTCCTGCTC 58.121 50.000 0.00 0.00 0.00 4.26
1 2 2.341846 TTTGTCCGTTCTTTCCTGCT 57.658 45.000 0.00 0.00 0.00 4.24
2 3 3.643159 ATTTTGTCCGTTCTTTCCTGC 57.357 42.857 0.00 0.00 0.00 4.85
3 4 6.142817 CAGTAATTTTGTCCGTTCTTTCCTG 58.857 40.000 0.00 0.00 0.00 3.86
4 5 5.826208 ACAGTAATTTTGTCCGTTCTTTCCT 59.174 36.000 0.00 0.00 0.00 3.36
5 6 6.068473 ACAGTAATTTTGTCCGTTCTTTCC 57.932 37.500 0.00 0.00 0.00 3.13
6 7 7.376072 CAGAACAGTAATTTTGTCCGTTCTTTC 59.624 37.037 0.00 0.00 39.52 2.62
7 8 7.066525 TCAGAACAGTAATTTTGTCCGTTCTTT 59.933 33.333 0.00 0.00 39.52 2.52
8 9 6.540914 TCAGAACAGTAATTTTGTCCGTTCTT 59.459 34.615 0.00 0.00 39.52 2.52
9 10 6.018180 GTCAGAACAGTAATTTTGTCCGTTCT 60.018 38.462 0.00 0.00 41.57 3.01
10 11 6.134061 GTCAGAACAGTAATTTTGTCCGTTC 58.866 40.000 0.00 0.00 33.22 3.95
11 12 5.008316 GGTCAGAACAGTAATTTTGTCCGTT 59.992 40.000 0.00 0.00 0.00 4.44
12 13 4.514066 GGTCAGAACAGTAATTTTGTCCGT 59.486 41.667 0.00 0.00 0.00 4.69
445 1925 0.111253 GCATCCAACCATAGAGGGGG 59.889 60.000 0.00 0.00 43.89 5.40
453 1933 5.422970 AGTGTTGAATAATGCATCCAACCAT 59.577 36.000 21.04 12.66 37.04 3.55
625 2108 9.713684 ATATTCATCACCCCTCTTAATTCAAAA 57.286 29.630 0.00 0.00 0.00 2.44
1343 2959 2.407340 AGGTGGAAGGAGTGAGTCTT 57.593 50.000 0.00 0.00 0.00 3.01
1400 3016 2.330216 AGGAAGGCCGCTTATCATAGT 58.670 47.619 0.00 0.00 39.96 2.12
1603 3219 1.157257 CGTACTGCTGCACAACCACA 61.157 55.000 0.00 0.00 0.00 4.17
3396 5017 0.544833 TACCTTTCTGGCCCGGTGTA 60.545 55.000 0.00 0.00 40.22 2.90
3951 5654 1.045407 TTGGTCGCCTGACTTACAGT 58.955 50.000 0.00 0.00 44.83 3.55
3994 5697 4.523173 CCTGTTTCTGGTGTCAGTAGACTA 59.477 45.833 0.00 0.00 45.20 2.59
4360 6253 1.501169 GGTTGTTGACTTGCATTGCC 58.499 50.000 6.12 0.00 0.00 4.52


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.