Multiple sequence alignment - TraesCS3A01G190400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G190400 chr3A 100.000 2264 0 0 1 2264 237052956 237055219 0.000000e+00 4181
1 TraesCS3A01G190400 chr2A 98.719 2264 29 0 1 2264 148615284 148613021 0.000000e+00 4021
2 TraesCS3A01G190400 chr2A 98.241 2274 29 3 1 2264 752002622 752004894 0.000000e+00 3967
3 TraesCS3A01G190400 chr2A 98.806 2178 26 0 1 2178 728933672 728935849 0.000000e+00 3879
4 TraesCS3A01G190400 chr7B 99.036 2178 21 0 1 2178 133432653 133430476 0.000000e+00 3906
5 TraesCS3A01G190400 chr7B 98.853 2179 24 1 1 2178 102652612 102654790 0.000000e+00 3884
6 TraesCS3A01G190400 chr7B 89.286 364 27 6 1913 2264 130335963 130336326 1.600000e-121 446
7 TraesCS3A01G190400 chr7B 89.011 364 28 6 1913 2264 235456091 235455728 7.420000e-120 440
8 TraesCS3A01G190400 chr7B 87.363 364 34 6 1913 2264 27328622 27328985 7.530000e-110 407
9 TraesCS3A01G190400 chr7B 87.895 190 11 6 2087 2264 335929294 335929483 1.760000e-51 213
10 TraesCS3A01G190400 chr5B 98.990 2178 22 0 1 2178 281832853 281830676 0.000000e+00 3901
11 TraesCS3A01G190400 chr5B 98.899 2179 24 0 1 2179 436476554 436478732 0.000000e+00 3892
12 TraesCS3A01G190400 chr4B 98.853 2179 24 1 1 2178 649623167 649625345 0.000000e+00 3884
13 TraesCS3A01G190400 chr4A 98.852 2178 25 0 1 2178 735292695 735294872 0.000000e+00 3884
14 TraesCS3A01G190400 chr4A 89.286 364 27 2 1913 2264 712879515 712879878 1.600000e-121 446
15 TraesCS3A01G190400 chr4A 83.420 386 30 8 1913 2264 698021541 698021156 6.030000e-86 327
16 TraesCS3A01G190400 chr1B 91.785 353 10 3 1913 2264 649299208 649298874 7.320000e-130 473


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G190400 chr3A 237052956 237055219 2263 False 4181 4181 100.000 1 2264 1 chr3A.!!$F1 2263
1 TraesCS3A01G190400 chr2A 148613021 148615284 2263 True 4021 4021 98.719 1 2264 1 chr2A.!!$R1 2263
2 TraesCS3A01G190400 chr2A 752002622 752004894 2272 False 3967 3967 98.241 1 2264 1 chr2A.!!$F2 2263
3 TraesCS3A01G190400 chr2A 728933672 728935849 2177 False 3879 3879 98.806 1 2178 1 chr2A.!!$F1 2177
4 TraesCS3A01G190400 chr7B 133430476 133432653 2177 True 3906 3906 99.036 1 2178 1 chr7B.!!$R1 2177
5 TraesCS3A01G190400 chr7B 102652612 102654790 2178 False 3884 3884 98.853 1 2178 1 chr7B.!!$F2 2177
6 TraesCS3A01G190400 chr5B 281830676 281832853 2177 True 3901 3901 98.990 1 2178 1 chr5B.!!$R1 2177
7 TraesCS3A01G190400 chr5B 436476554 436478732 2178 False 3892 3892 98.899 1 2179 1 chr5B.!!$F1 2178
8 TraesCS3A01G190400 chr4B 649623167 649625345 2178 False 3884 3884 98.853 1 2178 1 chr4B.!!$F1 2177
9 TraesCS3A01G190400 chr4A 735292695 735294872 2177 False 3884 3884 98.852 1 2178 1 chr4A.!!$F2 2177

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
362 363 0.252696 AGTGGCCTGAGTACCATGGA 60.253 55.0 21.47 0.0 38.46 3.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1656 1663 2.604614 CGATAGTTCATCATCGACGCCA 60.605 50.0 0.0 0.0 45.32 5.69 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
155 156 3.253188 GTGCTGCATTTGAGGTGAAACTA 59.747 43.478 5.27 0.0 36.74 2.24
312 313 1.480954 CTACTAGGTTGACATGGGCGT 59.519 52.381 0.00 0.0 0.00 5.68
362 363 0.252696 AGTGGCCTGAGTACCATGGA 60.253 55.000 21.47 0.0 38.46 3.41
376 377 3.602608 ACCATGGACCTCATATTAGGCT 58.397 45.455 21.47 0.0 40.62 4.58
1674 1681 1.749063 ACTGGCGTCGATGATGAACTA 59.251 47.619 9.31 0.0 0.00 2.24
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
155 156 1.071471 CTGGCACCACCGAGTCTTT 59.929 57.895 0.00 0.0 43.94 2.52
362 363 4.358614 AGAGGGTCTAGCCTAATATGAGGT 59.641 45.833 8.02 0.0 39.02 3.85
1656 1663 2.604614 CGATAGTTCATCATCGACGCCA 60.605 50.000 0.00 0.0 45.32 5.69
1674 1681 9.436957 AGTTCATACATTAAACAAAGTCTCGAT 57.563 29.630 0.00 0.0 0.00 3.59


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.