Multiple sequence alignment - TraesCS3A01G186300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G186300 chr3A 100.000 2393 0 0 1 2393 220015030 220017422 0.000000e+00 4420
1 TraesCS3A01G186300 chr3A 96.992 2394 70 2 1 2393 220023105 220025497 0.000000e+00 4021
2 TraesCS3A01G186300 chr3A 91.529 968 73 8 578 1541 263720887 263719925 0.000000e+00 1325
3 TraesCS3A01G186300 chr3A 90.909 968 81 6 578 1541 263712859 263711895 0.000000e+00 1293
4 TraesCS3A01G186300 chr3A 94.898 490 22 3 2 489 372417878 372418366 0.000000e+00 763
5 TraesCS3A01G186300 chr3A 91.080 213 10 4 1551 1763 598952508 598952305 1.810000e-71 279
6 TraesCS3A01G186300 chr3A 88.971 136 13 2 807 941 626415080 626414946 1.470000e-37 167
7 TraesCS3A01G186300 chr5A 94.049 1546 82 10 1 1541 96331144 96332684 0.000000e+00 2337
8 TraesCS3A01G186300 chr5A 93.800 500 24 7 2 498 315505245 315505740 0.000000e+00 745
9 TraesCS3A01G186300 chr2A 94.240 1389 57 9 175 1541 206909814 206911201 0.000000e+00 2100
10 TraesCS3A01G186300 chr2A 89.134 635 63 6 895 1528 303844208 303844837 0.000000e+00 785
11 TraesCS3A01G186300 chr2A 85.470 234 22 7 1533 1764 440040228 440040451 1.430000e-57 233
12 TraesCS3A01G186300 chr7A 96.324 1061 35 4 1 1059 394423976 394425034 0.000000e+00 1740
13 TraesCS3A01G186300 chr7A 95.947 1061 40 3 1 1059 394402476 394403535 0.000000e+00 1718
14 TraesCS3A01G186300 chr7A 90.063 1268 83 26 1162 2393 394425025 394426285 0.000000e+00 1604
15 TraesCS3A01G186300 chr7A 92.060 806 53 9 1592 2393 394418005 394418803 0.000000e+00 1123
16 TraesCS3A01G186300 chr7A 93.788 499 26 4 2 496 340493586 340494083 0.000000e+00 745
17 TraesCS3A01G186300 chr7A 91.480 223 15 3 705 926 295070999 295070780 1.070000e-78 303
18 TraesCS3A01G186300 chr7A 89.683 126 9 2 578 699 574541935 574541810 8.860000e-35 158
19 TraesCS3A01G186300 chr4A 96.167 861 29 3 1534 2393 285252902 285253759 0.000000e+00 1404
20 TraesCS3A01G186300 chr4A 95.829 863 31 3 1534 2393 285266506 285267366 0.000000e+00 1389
21 TraesCS3A01G186300 chr4A 95.587 861 35 2 1534 2393 285274432 285275290 0.000000e+00 1376
22 TraesCS3A01G186300 chr4A 95.476 862 35 3 1534 2393 285231817 285232676 0.000000e+00 1373
23 TraesCS3A01G186300 chr4A 95.470 861 36 2 1534 2393 285260834 285261692 0.000000e+00 1371
24 TraesCS3A01G186300 chr4A 90.588 255 20 3 688 942 378958765 378958515 3.810000e-88 335
25 TraesCS3A01G186300 chr4A 91.342 231 11 2 688 918 378951116 378950895 8.310000e-80 307
26 TraesCS3A01G186300 chr4A 94.262 122 7 0 578 699 294135015 294134894 1.130000e-43 187
27 TraesCS3A01G186300 chr1A 95.581 860 34 3 1534 2393 280191052 280191907 0.000000e+00 1375
28 TraesCS3A01G186300 chr1A 93.173 498 26 7 1 493 377845281 377844787 0.000000e+00 725
29 TraesCS3A01G186300 chr1A 89.126 515 49 6 1029 1539 428859048 428859559 3.360000e-178 634
30 TraesCS3A01G186300 chr1A 88.588 517 52 6 1029 1541 163669334 163668821 2.610000e-174 621
31 TraesCS3A01G186300 chr1A 87.931 522 54 8 1029 1545 428867216 428867733 7.320000e-170 606
32 TraesCS3A01G186300 chr1A 93.069 101 7 0 816 916 206350575 206350675 5.330000e-32 148
33 TraesCS3A01G186300 chr6A 92.079 101 8 0 816 916 347164517 347164617 2.480000e-30 143
34 TraesCS3A01G186300 chr6A 89.109 101 11 0 819 919 264791473 264791373 2.500000e-25 126


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G186300 chr3A 220015030 220017422 2392 False 4420 4420 100.0000 1 2393 1 chr3A.!!$F1 2392
1 TraesCS3A01G186300 chr3A 220023105 220025497 2392 False 4021 4021 96.9920 1 2393 1 chr3A.!!$F2 2392
2 TraesCS3A01G186300 chr3A 263719925 263720887 962 True 1325 1325 91.5290 578 1541 1 chr3A.!!$R2 963
3 TraesCS3A01G186300 chr3A 263711895 263712859 964 True 1293 1293 90.9090 578 1541 1 chr3A.!!$R1 963
4 TraesCS3A01G186300 chr5A 96331144 96332684 1540 False 2337 2337 94.0490 1 1541 1 chr5A.!!$F1 1540
5 TraesCS3A01G186300 chr2A 206909814 206911201 1387 False 2100 2100 94.2400 175 1541 1 chr2A.!!$F1 1366
6 TraesCS3A01G186300 chr2A 303844208 303844837 629 False 785 785 89.1340 895 1528 1 chr2A.!!$F2 633
7 TraesCS3A01G186300 chr7A 394402476 394403535 1059 False 1718 1718 95.9470 1 1059 1 chr7A.!!$F2 1058
8 TraesCS3A01G186300 chr7A 394423976 394426285 2309 False 1672 1740 93.1935 1 2393 2 chr7A.!!$F4 2392
9 TraesCS3A01G186300 chr7A 394418005 394418803 798 False 1123 1123 92.0600 1592 2393 1 chr7A.!!$F3 801
10 TraesCS3A01G186300 chr4A 285252902 285253759 857 False 1404 1404 96.1670 1534 2393 1 chr4A.!!$F2 859
11 TraesCS3A01G186300 chr4A 285266506 285267366 860 False 1389 1389 95.8290 1534 2393 1 chr4A.!!$F4 859
12 TraesCS3A01G186300 chr4A 285274432 285275290 858 False 1376 1376 95.5870 1534 2393 1 chr4A.!!$F5 859
13 TraesCS3A01G186300 chr4A 285231817 285232676 859 False 1373 1373 95.4760 1534 2393 1 chr4A.!!$F1 859
14 TraesCS3A01G186300 chr4A 285260834 285261692 858 False 1371 1371 95.4700 1534 2393 1 chr4A.!!$F3 859
15 TraesCS3A01G186300 chr1A 280191052 280191907 855 False 1375 1375 95.5810 1534 2393 1 chr1A.!!$F2 859
16 TraesCS3A01G186300 chr1A 428859048 428859559 511 False 634 634 89.1260 1029 1539 1 chr1A.!!$F3 510
17 TraesCS3A01G186300 chr1A 163668821 163669334 513 True 621 621 88.5880 1029 1541 1 chr1A.!!$R1 512
18 TraesCS3A01G186300 chr1A 428867216 428867733 517 False 606 606 87.9310 1029 1545 1 chr1A.!!$F4 516

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
838 863 2.673523 CCTTCCTCCCAGCACCAG 59.326 66.667 0.0 0.0 0.0 4.0 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1924 1993 0.388907 CAAAAGAGGGGCAACATGCG 60.389 55.0 0.0 0.0 46.21 4.73 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
293 296 7.928307 TGTTTTGGTTGAATTCAAAAATGGA 57.072 28.000 22.07 3.77 42.23 3.41
473 478 9.185192 CTCTATTTGTTTTCCTGTTAAAGCAAG 57.815 33.333 0.00 0.00 39.60 4.01
838 863 2.673523 CCTTCCTCCCAGCACCAG 59.326 66.667 0.00 0.00 0.00 4.00
1207 1232 1.534476 TGCCCCACTTACGTCCTCA 60.534 57.895 0.00 0.00 0.00 3.86
1449 1480 3.243602 TGTGGATTTCGTCAAGTTCGAGA 60.244 43.478 0.00 0.00 38.52 4.04
1549 1581 2.151202 CCAACAAGTACCACGATGCTT 58.849 47.619 0.00 0.00 0.00 3.91
1645 1712 2.949177 TGCCAAGTACCACTCATGTT 57.051 45.000 0.00 0.00 0.00 2.71
1664 1731 2.127232 GCAAGAACCGCAAGTCGC 60.127 61.111 0.00 0.00 36.73 5.19
1705 1772 1.267806 CGTGGACCGTGTACAACTACT 59.732 52.381 0.00 0.00 0.00 2.57
1819 1886 3.128938 CCTCTACGAACTTGATCCGTTCT 59.871 47.826 17.60 10.44 38.82 3.01
1834 1901 3.452990 TCCGTTCTGATAATGCACCCTTA 59.547 43.478 0.00 0.00 0.00 2.69
1907 1974 1.266718 GAAATGCTCGTGTTTGCTCCA 59.733 47.619 0.00 0.00 0.00 3.86
1924 1993 1.635663 CCATGTCGGAGTTGTTCGGC 61.636 60.000 0.00 0.00 36.56 5.54
2015 2084 3.298958 ATGACACGCTCCCGTCAT 58.701 55.556 0.00 0.00 46.39 3.06
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
473 478 3.883489 GCTCTCTTCTCTCTCCCTCTAAC 59.117 52.174 0.00 0.00 0.00 2.34
520 525 1.291906 CAAATGGGCCACGGGAAAC 59.708 57.895 9.28 0.00 0.00 2.78
559 564 3.966543 CTGCGGGGAAGGTTGGGT 61.967 66.667 0.00 0.00 0.00 4.51
605 610 3.136443 CAGGGAATGATAGGGTTACAGCA 59.864 47.826 0.00 0.00 0.00 4.41
997 1022 2.894387 GAGCTGCGAGGCCATGAC 60.894 66.667 5.01 0.00 0.00 3.06
1075 1100 4.996434 GCCGTGGTGCTCTGCTGT 62.996 66.667 0.00 0.00 0.00 4.40
1207 1232 3.003763 GCGTGGAGGGAGGAGGTT 61.004 66.667 0.00 0.00 0.00 3.50
1531 1563 3.120321 TCAAGCATCGTGGTACTTGTT 57.880 42.857 0.00 0.00 40.29 2.83
1549 1581 1.639722 TGGTGAATCCGAGGTCTTCA 58.360 50.000 6.03 6.03 39.52 3.02
1645 1712 2.250939 CGACTTGCGGTTCTTGCCA 61.251 57.895 0.00 0.00 36.03 4.92
1664 1731 2.237751 GCGTCGATCATTCGGGGTG 61.238 63.158 0.00 0.00 45.53 4.61
1705 1772 1.371267 CAACGTCTTCGGAGCGACA 60.371 57.895 13.35 0.00 41.85 4.35
1834 1901 1.680207 GTCTCGGCGGTTATACCTTCT 59.320 52.381 7.21 0.00 35.66 2.85
1907 1974 1.736645 CGCCGAACAACTCCGACAT 60.737 57.895 0.00 0.00 0.00 3.06
1924 1993 0.388907 CAAAAGAGGGGCAACATGCG 60.389 55.000 0.00 0.00 46.21 4.73
2015 2084 2.164338 GGATACCGGTGCAAAAGGAAA 58.836 47.619 19.93 0.00 0.00 3.13
2162 2231 8.763356 TGACATGAACAAGTTTATGCAATTTTC 58.237 29.630 15.10 7.04 39.34 2.29
2163 2232 8.659925 TGACATGAACAAGTTTATGCAATTTT 57.340 26.923 15.10 0.00 39.34 1.82


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.