Multiple sequence alignment - TraesCS3A01G183400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3A01G183400 chr3A 100.000 2607 0 0 1 2607 212711042 212713648 0 4815
1 TraesCS3A01G183400 chr7B 98.889 2610 23 6 1 2607 147712446 147715052 0 4654
2 TraesCS3A01G183400 chr7A 98.813 2612 22 8 1 2607 549403792 549401185 0 4643
3 TraesCS3A01G183400 chr7A 98.506 2611 31 8 1 2607 393650424 393647818 0 4599
4 TraesCS3A01G183400 chr2A 98.774 2611 25 7 1 2607 306624732 306627339 0 4638
5 TraesCS3A01G183400 chr5A 98.736 2610 28 5 1 2607 687724734 687722127 0 4632
6 TraesCS3A01G183400 chr3B 98.697 2609 28 6 1 2607 798428183 798430787 0 4625
7 TraesCS3A01G183400 chr3B 98.697 2609 27 7 1 2607 193971334 193968731 0 4623
8 TraesCS3A01G183400 chr1A 98.622 2612 28 8 1 2607 531039279 531041887 0 4617
9 TraesCS3A01G183400 chr6A 98.583 2611 31 6 1 2607 90762918 90765526 0 4612


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3A01G183400 chr3A 212711042 212713648 2606 False 4815 4815 100.000 1 2607 1 chr3A.!!$F1 2606
1 TraesCS3A01G183400 chr7B 147712446 147715052 2606 False 4654 4654 98.889 1 2607 1 chr7B.!!$F1 2606
2 TraesCS3A01G183400 chr7A 549401185 549403792 2607 True 4643 4643 98.813 1 2607 1 chr7A.!!$R2 2606
3 TraesCS3A01G183400 chr7A 393647818 393650424 2606 True 4599 4599 98.506 1 2607 1 chr7A.!!$R1 2606
4 TraesCS3A01G183400 chr2A 306624732 306627339 2607 False 4638 4638 98.774 1 2607 1 chr2A.!!$F1 2606
5 TraesCS3A01G183400 chr5A 687722127 687724734 2607 True 4632 4632 98.736 1 2607 1 chr5A.!!$R1 2606
6 TraesCS3A01G183400 chr3B 798428183 798430787 2604 False 4625 4625 98.697 1 2607 1 chr3B.!!$F1 2606
7 TraesCS3A01G183400 chr3B 193968731 193971334 2603 True 4623 4623 98.697 1 2607 1 chr3B.!!$R1 2606
8 TraesCS3A01G183400 chr1A 531039279 531041887 2608 False 4617 4617 98.622 1 2607 1 chr1A.!!$F1 2606
9 TraesCS3A01G183400 chr6A 90762918 90765526 2608 False 4612 4612 98.583 1 2607 1 chr6A.!!$F1 2606

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
100 101 2.401699 CTGGTCCTGTGAGGCAGCAA 62.402 60.0 0.0 0.0 43.71 3.91 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2061 2073 2.14473 AGCGTAAACGTGCATAAACCA 58.855 42.857 4.24 0.0 42.22 3.67 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
20 21 3.322466 CCTCACGAGGGCAAGGGT 61.322 66.667 5.08 0.0 44.87 4.34
100 101 2.401699 CTGGTCCTGTGAGGCAGCAA 62.402 60.000 0.00 0.0 43.71 3.91
850 855 7.831690 TGGCAACTTGATAGTAAAATACATGGA 59.168 33.333 0.00 0.0 33.17 3.41
1195 1203 2.295349 GAGACTTGGAACCGTCACTACA 59.705 50.000 0.00 0.0 31.56 2.74
1382 1392 2.425312 TGTCCATTTTTGCGTGTTCACT 59.575 40.909 1.53 0.0 0.00 3.41
1673 1684 9.483489 TTGTTGAGGAATGTAAGGTACTATCTA 57.517 33.333 0.00 0.0 38.49 1.98
2061 2073 3.433306 TGTAGCCATAACCTTTGCTGT 57.567 42.857 0.00 0.0 35.34 4.40
2267 2281 5.626809 GCAGATCCAGTACAACTTACATGGA 60.627 44.000 0.00 0.0 40.86 3.41
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
20 21 3.193267 GCAGGCACATTGGAACTTGATTA 59.807 43.478 0.00 0.0 0.00 1.75
251 252 3.330110 AGCAAGATGAGAGATTATGGGGG 59.670 47.826 0.00 0.0 0.00 5.40
1195 1203 4.768968 CCTGATCTGGACCTTTGAATGTTT 59.231 41.667 13.18 0.0 0.00 2.83
1673 1684 7.730364 ACATAGTTTTCGACAAAGAACAGAT 57.270 32.000 0.00 0.0 0.00 2.90
1918 1930 5.182001 GTCTGTTGAACTACATTTGCCATCT 59.818 40.000 0.00 0.0 0.00 2.90
2061 2073 2.144730 AGCGTAAACGTGCATAAACCA 58.855 42.857 4.24 0.0 42.22 3.67
2267 2281 5.772672 TGCCATGTTAGTTGTACTGGATTTT 59.227 36.000 0.00 0.0 0.00 1.82


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.